View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14527_low_7 (Length: 256)
Name: NF14527_low_7
Description: NF14527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14527_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 35426073 - 35425839
Alignment:
| Q |
17 |
tctctacattgaaaatattgtagtttctctgannnnnnnnnnnnnagaatttaaaatttgatttctaatcttgtcttgatgttatacatacaatgatgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35426073 |
tctctacattgaaaatattgtagtttctctgatttttttttttt-agaatttaaaatttgatttctaatcttgtcttgatgttatacatacaatgatgca |
35425975 |
T |
|
| Q |
117 |
catctttaatcttgtctagaaagttaaattgttctgcataatgaagactgaatgcttgctaaatgctgacattctctgacaaaaggaggaccaggtctcc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35425974 |
catctttaatcttgtctagaaagttaaattgttctgcataatgaagactgaatgcttgctaaatgttgacattctctgacaaaaggaggaccaggtctcc |
35425875 |
T |
|
| Q |
217 |
acatctgttttcttgcaaatacaatgtcctttgctt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35425874 |
acatctgttttcttgcaaatacaatgtcctttgctt |
35425839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University