View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14527_low_8 (Length: 231)
Name: NF14527_low_8
Description: NF14527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14527_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 214
Target Start/End: Original strand, 27524666 - 27524863
Alignment:
| Q |
15 |
aagggcaattcttcaaaaagatatattgctattgcatatatattgcaaaagacacgactaaagatgcactaattcctaaattcgagccacatgatgataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| | |||||||||||||||||||| |
|
|
| T |
27524666 |
aagggcaattcttcaaaaagatatattgctattgcatatatattgcaaaagacacgactaaagaggcgctaattccca--ttcgagccacatgatgataa |
27524763 |
T |
|
| Q |
115 |
tgtgatctgttggcctgaagaggacactctcgtactgagcaggtatatgaacatccagtgaataagaaagaaaaataccatgctgaggatattgaataat |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27524764 |
tgtgatctattggcctgaagaggacactctcgtactgagcaggtatatgaacatccagtgaataagaaagaaaaataccatgctgaggatattgaataat |
27524863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University