View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14527_low_9 (Length: 202)
Name: NF14527_low_9
Description: NF14527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14527_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 42178486 - 42178309
Alignment:
| Q |
11 |
gaagaatatctctcaattttt-acacctaagcttgctatgacgttaatttgagtggtgcatttt-gtttcatgagcggttctatatggcatgatactcta |
108 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178486 |
gaagaatatctcacaattttttacacctaagcttgctatgacgttaatttgagaggtgcatttttgtttcatgagcggttctatatggcatgatactcta |
42178387 |
T |
 |
| Q |
109 |
tcacacaaattgcacatgacatgaatgtgttttccatgcttgttttgcttgtctcatgaatgtgcttatgcttcttat |
186 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178386 |
tcacacaaattgcacatgacatgagtgtgttttccatgcttgttttgcttgtctcatgaatgtgcttatgcttcttat |
42178309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University