View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1452_low_5 (Length: 367)
Name: NF1452_low_5
Description: NF1452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1452_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 139 - 364
Target Start/End: Complemental strand, 41747841 - 41747616
Alignment:
| Q |
139 |
cgatcacaatgtcgtggatgaaagttttgattctgcagcgaggggtaaaattggaatgtgttggattttcttcttcgtcagaagaagaatccgtggcgtc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41747841 |
cgatcacaatgtcgtggatgaaagttttgattctgcggcgaggggtaatattggaatgtattggattttcttcttcgtcagaagaagaatccgtggcgtc |
41747742 |
T |
 |
| Q |
239 |
agggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttaggaataggaggaggtgta |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41747741 |
agggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttgggaatgggaggaggtgta |
41747642 |
T |
 |
| Q |
339 |
gaaggttgtttaggcatattcttgga |
364 |
Q |
| |
|
||||||||||| ||||| || ||||| |
|
|
| T |
41747641 |
gaaggttgtttgggcatgttgttgga |
41747616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 41747959 - 41747900
Alignment:
| Q |
21 |
tgtctcactccacgatatttcttcccggtgcaaatcaccggccgccgttgagtcgccgga |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41747959 |
tgtctcactccacgatatttcttcccggtgtaaatcaccggccgccgttgagtcgccgga |
41747900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University