View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14530_high_3 (Length: 276)
Name: NF14530_high_3
Description: NF14530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14530_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 9843853 - 9843601
Alignment:
| Q |
18 |
gtggtcacatccaacactctagatcatgataacataactacaacaacaaagacccaccaatagtaagaacaaaattgttttttgatagggatagtaagag |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9843853 |
gtggtcacatccatcactctagatcatgataacataactacaacaacaaagacccaccagtagtaagaacaaaattgttttttgataggaatagtaagag |
9843754 |
T |
 |
| Q |
118 |
caaaattgtgatggattttgct---gtcaaacaataacatatttagtcaatataacgtagtattatttttactataattttcatttgacttgatttaaga |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9843753 |
caaaattgtgatggattttgctgtagtcaaacaataacatatttagtcaatataac---atattatttttactataattttcatttgacttgatttaaga |
9843657 |
T |
 |
| Q |
215 |
tgg--gcgtgcgggtgtgggtgcg-cgcacgcaagtgcgcacatgtcgctttatac |
267 |
Q |
| |
|
||| ||||||||||| | ||| | ||| ||| |||||||||||||||||||||| |
|
|
| T |
9843656 |
tgggtgcgtgcgggtgggtgtgtgtcgcgcgcgtgtgcgcacatgtcgctttatac |
9843601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 9836135 - 9836002
Alignment:
| Q |
18 |
gtggtcacatccaacactctagatcatgataacataactacaacaacaaagacccaccaatagtaagaacaaaattgttttttgatagggatagtaagag |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9836135 |
gtggtcacatccaccactctagatcatgataacataactacaacaacaaagacccaccaatagtaagaacaaaattgttttttgataggaatagtaagag |
9836036 |
T |
 |
| Q |
118 |
caaaattgtgatggattttgctgtcaaacaataa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9836035 |
caaaattgtgatggattttgctgtcaaacaataa |
9836002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University