View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14530_low_4 (Length: 234)
Name: NF14530_low_4
Description: NF14530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14530_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 51361913 - 51361784
Alignment:
| Q |
1 |
accaatacagtcatcctttcaggaaagttattcccttcaaccctcagccatggtaactatctgctcatctcgtgcaccataatatagagagtgttcatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51361913 |
accaatacagtcatcctttcaggaaagttattcccttccaccctcagccatggtaactatctgctcatctcgtgcaccataatat--agagtgttcatgt |
51361816 |
T |
|
| Q |
101 |
taacatgtttaatgtgttttcccctacttaaa |
132 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
51361815 |
taacatgtttaatatgttttcccctacttaaa |
51361784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 130 - 232
Target Start/End: Complemental strand, 51361735 - 51361633
Alignment:
| Q |
130 |
aaacattgttcaaaaaatattctgcatgaccattattttagctatctatacaaacaccttggttggttgtgttttcttagaattttgatttcttctcact |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||| |
|
|
| T |
51361735 |
aaacattgttcaaaaaatattctgcatgaccattattttagctatctatacaaacaccttggttggttgtgttttctttgaattttgatttcttttaact |
51361636 |
T |
|
| Q |
230 |
cga |
232 |
Q |
| |
|
||| |
|
|
| T |
51361635 |
cga |
51361633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University