View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14531_low_6 (Length: 267)
Name: NF14531_low_6
Description: NF14531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14531_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 71 - 240
Target Start/End: Original strand, 34507417 - 34507586
Alignment:
| Q |
71 |
ctgtgccatatgatccacttatggagttgtttgagtctgcatggctcatgaatcctggcagtttctgggataaagcagagaaagagagagattagtacaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34507417 |
ctgtgccatatgatccacttatggagttgtttgagtctgcatggctcatgaatcctggcagtttctgggataaagcagagaaagagagagattagtacaa |
34507516 |
T |
 |
| Q |
171 |
ttaactaggatattataagagtcatgtacgactatagcattttcatggctacttcaaaaatgtgagtgcc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34507517 |
ttaactaggatattataagagtcatgtacgactatagcattttcatggctacttcaaaaatgtgagtgcc |
34507586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University