View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14532_high_8 (Length: 248)
Name: NF14532_high_8
Description: NF14532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14532_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 41591318 - 41591087
Alignment:
| Q |
1 |
aatttgtagatcatactccatgctgctttccaacatcaaagatcaactaaacaacccaagcannnnnnnnncatttggaagaaacacaaacatgagagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41591318 |
aatttgtagatcatactccatgctgctttccaacatcaaagatcaactaaacaacccaagcatttttttttcatttggaagaaacacaaacatgagagta |
41591219 |
T |
|
| Q |
101 |
aatttaccnnnnnnncccttcaaatcaatatacctctgaaacattttggtacacaaatttaccaaatgaggcctttgtttggaactgtgctgggaagcct |
200 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41591218 |
aattcacctttttttcccttcaaatcaatatacctctgaaacattttggtacacaagtttaccaaatgaggcctttgtttggaactgttctgggaagcct |
41591119 |
T |
|
| Q |
201 |
gatagacgcgtgtttttcggaagcaacaaatg |
232 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
41591118 |
gatagacgcgtgtttttctgaagcaacaaatg |
41591087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 41574865 - 41574804
Alignment:
| Q |
1 |
aatttgtagatcatactccatgctgctttccaacatcaaagatcaactaaacaacccaagca |
62 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41574865 |
aatttgtggatcatactccatgctgctttccaacaccaaagatcaactaaacaacccaagca |
41574804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University