View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14532_low_10 (Length: 232)
Name: NF14532_low_10
Description: NF14532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14532_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 5464145 - 5463945
Alignment:
| Q |
10 |
gaagaatatattcaatatttgttcaaacaagaaacaggacttggatttggatccatcactcattttttatgctacgatgatcgtgatgttgaggttgaag |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
5464145 |
gaagaatacattcaatatttgttcaaacaagaaacaggacttggatttggatccatcactcattttttatgctatgatgatcatgatgttgaagttgaag |
5464046 |
T |
 |
| Q |
110 |
atgatgattcaaacaaaagcttattctggttgagaaatgctcgtttgcatgctattgattggattttcaatgttagttttcacaaaacaattcaaaattt |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5464045 |
atgatgattcaagcaaaagcttattctggttgagaaatgctcgtttgcatgctattgattggattttcaatgttagttttcacaaaacaattcaaaattt |
5463946 |
T |
 |
| Q |
210 |
g |
210 |
Q |
| |
|
| |
|
|
| T |
5463945 |
g |
5463945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University