View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14532_low_7 (Length: 262)
Name: NF14532_low_7
Description: NF14532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14532_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 45547841 - 45547587
Alignment:
| Q |
1 |
tatcggagatttagttgaacaaaatataacatcagatttcccatggccaaaaccggaacnnnnnnnn-------ctaccctgttacgtaatatttcccaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
45547841 |
tatcggagatttagttgaacaaaatataacatcagatttcccatggccaaaacatgaagaaaaaaaaaagaaagctaccctgttacgtaatatttcccaa |
45547742 |
T |
|
| Q |
94 |
gcaacgcagatgattgatagacataatcgtctcgcaaagaatttcagaaaagttcgtgatttagttgaacaaaatataacttctgatttttgtttgaggt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
45547741 |
gcaacgcagatgattgatagacataatcgtctcgcaaagaatttcagaaaagttcgtgatttagttgaacaaaatgtaacatctgatttttgtttgaggt |
45547642 |
T |
|
| Q |
194 |
tgacgagaaatcgttcaaaggatgctaggatgcacaacataccagaagttgatga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45547641 |
tgacgagaaatcgttcaaaggatgctaggatgcacaacataccagaagttgatga |
45547587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University