View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14533_high_8 (Length: 241)
Name: NF14533_high_8
Description: NF14533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14533_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 22191090 - 22191029
Alignment:
| Q |
1 |
atagtttatataatttattttctttgagagtacgttcctcagtgaaggtgaatcaataacaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
22191090 |
atagtttatataatttattttctttgagagtaaggtcctcagtgaaggtgaatcaataacaa |
22191029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University