View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14533_low_13 (Length: 214)
Name: NF14533_low_13
Description: NF14533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14533_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 24265938 - 24265758
Alignment:
| Q |
18 |
agaaaattgatttttgaatgtgatggggatatataacaaactgacctgaatcaatgttagcaatgattgtaccctcaccatatcttgccttctcccatat |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24265938 |
agaaaattgatttttgaatgtgatggg-atatataacaaactgacctgaatcaatgttagcaatgattgtaccctcaccatatcttcccttctcccatat |
24265840 |
T |
|
| Q |
118 |
ggagtctttgggaaccactccataattgttctctagcccaagaaattcccatgatcttgtggtttgcaattcatgccctttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24265839 |
ggagtctttgggaaccactccataattgttctctagcccaagaaattcccatgatcttgtggtttgcaattcatgccctttg |
24265758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 61 - 120
Target Start/End: Complemental strand, 42309589 - 42309530
Alignment:
| Q |
61 |
acctgaatcaatgttagcaatgattgtaccctcaccatatcttgccttctcccatatgga |
120 |
Q |
| |
|
||||| ||||| |||| |||||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
42309589 |
acctgtatcaaggttaccaatgattgtgtcttcaccatatcttgccttctcccaaatgga |
42309530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University