View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14533_low_5 (Length: 332)
Name: NF14533_low_5
Description: NF14533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14533_low_5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 5 - 332
Target Start/End: Original strand, 34677787 - 34678115
Alignment:
| Q |
5 |
gttgttaaagagaaagagacattggactaagaagg-aggagatgttgtttggttcaagttttgtgtattaattgccttgattttgaaggagggaaagatg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34677787 |
gttgttaaagagaaagagacattggactaagaagggaggagatgttgtttggttcaagttttgtgtattaattgccttgattttgaaggagggaaagatg |
34677886 |
T |
 |
| Q |
104 |
aaaatattagatatatgtaacttaaggtttgtttggtgtgtatctatgcttggctttgcctcaacatgaagctttttagcatatagtttttggagtttgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34677887 |
aaaatattagatatatgtaacttaaggtttgtttggtgtgtatctatgcttggctttgcctcaacatgaagctttttagcatatagtttttggagtttgg |
34677986 |
T |
 |
| Q |
204 |
actatgacataaaattaacttctatatggaaaatgacacactctctacttggagtgaaaattcaggaagctttatttctttttattttggtctcttggta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34677987 |
actatgacataaaattaacttctatatggaaaatgacacactctctacttggagtgaaaattcaggaagctttatttctttttattttggtctcttggta |
34678086 |
T |
 |
| Q |
304 |
atatatgcaaatataaggttgttgaagcc |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34678087 |
atatatgcaaatataaggttgttgaagcc |
34678115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University