View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14533_low_8 (Length: 243)
Name: NF14533_low_8
Description: NF14533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14533_low_8 |
 |  |
|
| [»] scaffold0271 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 41412649 - 41412852
Alignment:
| Q |
20 |
ttattgattcaaacatcagattccttctctggattattgttgttcactattgggttccttgtgttcatggttgcatgtgttaaggatatggagtttcaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41412649 |
ttattgattcaaacatcagattccttctctggattattgttgttcactattgggttccttgtgttcatggttgcatgtgttaaggatatggagtttcaga |
41412748 |
T |
 |
| Q |
120 |
gtttctttgctaaagggtgtgtttttcttcatatttcaatggcagtttggagattttactttgtagggaaggttgaagaactggcttgtgattggcctag |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41412749 |
gtttctttgctaaaggatgtgtttttcttcatatttcaatggcagtttggagattttactttgtagcgaaggttgaagaactggcttgtgattggcctag |
41412848 |
T |
 |
| Q |
220 |
gcat |
223 |
Q |
| |
|
|||| |
|
|
| T |
41412849 |
gcat |
41412852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0271 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: scaffold0271
Description:
Target: scaffold0271; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 18718 - 18515
Alignment:
| Q |
20 |
ttattgattcaaacatcagattccttctctggattattgttgttcactattgggttccttgtgttcatggttgcatgtgttaaggatatggagtttcaga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
18718 |
ttattgattcaaacatcagattccttctctggattattgttgttcacaatagggtttcttgtgttcatggttgcttgtgttaaggatatggagtttcaaa |
18619 |
T |
 |
| Q |
120 |
gtttctttgctaaagggtgtgtttttcttcatatttcaatggcagtttggagattttactttgtagggaaggttgaagaactggcttgtgattggcctag |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18618 |
gtttctttgctaaagggtgtgtgtttcttcatatttcaatggcagtttggagattttactttgtagggaaggttgaagaacttgcttgtgattggcctag |
18519 |
T |
 |
| Q |
220 |
gcat |
223 |
Q |
| |
|
|||| |
|
|
| T |
18518 |
gcat |
18515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University