View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14533_low_9 (Length: 241)

Name: NF14533_low_9
Description: NF14533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14533_low_9
NF14533_low_9
[»] chr3 (1 HSPs)
chr3 (1-62)||(22191029-22191090)


Alignment Details
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 22191090 - 22191029
Alignment:
1 atagtttatataatttattttctttgagagtacgttcctcagtgaaggtgaatcaataacaa 62  Q
    |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||    
22191090 atagtttatataatttattttctttgagagtaaggtcctcagtgaaggtgaatcaataacaa 22191029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University