View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14534_high_14 (Length: 250)
Name: NF14534_high_14
Description: NF14534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14534_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 100 - 226
Target Start/End: Complemental strand, 1686054 - 1685928
Alignment:
| Q |
100 |
caaactatcactaaagataatcgcaacaaactatcactaaagataatgacaacaaactttttattcaagcaacaaaaacactatataagcatatagtttc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1686054 |
caaactatcactaaagataatcgcaacaaactatcactaaagataatgacaacaaactttttattcaagcaacaaaaacactatataagcatatagtctc |
1685955 |
T |
 |
| Q |
200 |
actcttcttctacgctcacactttcca |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1685954 |
actcttcttctacgctcacactttcca |
1685928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 1686135 - 1686082
Alignment:
| Q |
23 |
aatgcgtgtagtcgagctaatc-aattttcaaataaatagataacttcaaattt |
75 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1686135 |
aatgcgtgtagtcgagctaatccaattttcaaataaatagataacttcaaattt |
1686082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University