View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14534_high_9 (Length: 366)
Name: NF14534_high_9
Description: NF14534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14534_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 288 - 346
Target Start/End: Complemental strand, 15084667 - 15084609
Alignment:
| Q |
288 |
ggggacccttgttgacttcacaagtctatgcaaaacattttactaccatatatacctac |
346 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
15084667 |
ggggacccttgttgacttcacaagtcaaggcaaaacattttactaccatatatacctac |
15084609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 94 - 153
Target Start/End: Complemental strand, 18656864 - 18656805
Alignment:
| Q |
94 |
caattcaactggttatgacttactgcagttaagatatttattttctcacctaatattttt |
153 |
Q |
| |
|
||||||||||||||||||| ||| | ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
18656864 |
caattcaactggttatgacctacagtagtgaagatttttattttctcacctaacattttt |
18656805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 94 - 153
Target Start/End: Complemental strand, 18689346 - 18689287
Alignment:
| Q |
94 |
caattcaactggttatgacttactgcagttaagatatttattttctcacctaatattttt |
153 |
Q |
| |
|
||||||||||||||||||| ||| | || ||||| ||||||||||||||||| |||||| |
|
|
| T |
18689346 |
caattcaactggttatgacctacagtggtgaagatttttattttctcacctaacattttt |
18689287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University