View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14534_low_13 (Length: 290)
Name: NF14534_low_13
Description: NF14534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14534_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 7474972 - 7474701
Alignment:
| Q |
1 |
aatttcaccaactgaggggcaaccttctcggttaaagaccgatgctttctatcggatgacgttgccgagatcaaaggctccctttcttatgttgtgcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474972 |
aatttcaccaactgaggggcaaccttctcagttaaagaccgatgctttctatgggatgacgttgccgagatcaaaggctccctttcttatgttgtgcatt |
7474873 |
T |
 |
| Q |
101 |
gtttgtcattttactgattgcgtgaaaatttgggtaatggatcatagtggatgggagaaaaagtacaacattagctcaattgtgccaatgtttcgtatgc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474872 |
gt----cattttactgattgcgtgaaaatttgggtaatggatcatagtggatgggagaaaaagtacaacattagctcaattgtgccaatgtttcgtatgg |
7474777 |
T |
 |
| Q |
201 |
gcggtctttggaagaatggtgatcaactccttggaggaaaggatggaaagtccctcgcatcatatgaccatgaagg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474776 |
gcggtctttggaagaatggtgatcaactccttggaggaaaggatggaaagtccctcgcatcatatgaccatgaagg |
7474701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 247
Target Start/End: Complemental strand, 7487723 - 7487604
Alignment:
| Q |
128 |
atttgggtaatggatcatagtggatgggagaaaaagtacaacattagctcaattgtgccaatgtttcgtatgcgcggtctttggaagaatggtgatcaac |
227 |
Q |
| |
|
|||||||| |||||||| ||||||||| | ||||||| ||||||| || || ||||| |||||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
7487723 |
atttgggtgatggatcaaagtggatggcacaaaaagtgcaacattggcccacttgtgtcaatgtttcgtatgtgtggcctttggaagaatggcgatcaaa |
7487624 |
T |
 |
| Q |
228 |
tccttggaggaaaggatgga |
247 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
7487623 |
tccttggaggaaaggttgga |
7487604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 7873627 - 7873743
Alignment:
| Q |
128 |
atttgggtaatggatcatagtggatgggagaaaaagtacaacatta---gctcaattgtgccaatgtttcgtatgcgcggtctttggaagaatggtgatc |
224 |
Q |
| |
|
||||||||||||||||| ||||||||| | |||||||||||||||| || || |||| |||||| |||||||| ||| |||||||||||||| ||| |
|
|
| T |
7873627 |
atttgggtaatggatcaaagtggatggcacaaaaagtacaacattattggcccacctgtgtcaatgtctcgtatgctcggcctttggaagaatggcgatg |
7873726 |
T |
 |
| Q |
225 |
aactccttggaggaaag |
241 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7873727 |
aactccttggaggaaag |
7873743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 239
Target Start/End: Original strand, 6944318 - 6944437
Alignment:
| Q |
123 |
tgaaaatttgggtaatggatcatag---tggatgggagaaaaagtacaacattagctcaattgtg-ccaatgtttcgtatgcgcggtctttggaagaatg |
218 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||| | || | || |||| ||||| ||| |||||||||||||||| | |
|
|
| T |
6944318 |
tgaaaatttgggtaatggatcatcgaaatggatgggagaaaaagtacaacattgtcccacctttgttcaat-tttcgaatgtgcggtctttggaagaacg |
6944416 |
T |
 |
| Q |
219 |
gtgatcaactccttggaggaa |
239 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
6944417 |
gggatcaactccttggaggaa |
6944437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 128 - 276
Target Start/End: Complemental strand, 7495198 - 7495050
Alignment:
| Q |
128 |
atttgggtaatggatcatagtggatgggagaaaaa-gtacaacattagctcaattgtgccaatgtttcgtatgcgcggtctttggaagaatggtgatcaa |
226 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| ||| |||||| || || || | |||||||||| ||| || |||||||||||| | ||||| |
|
|
| T |
7495198 |
atttgggtaatggatcaaagtggatgg-agaaaaatgtataacattggcccagttttttcaatgtttcgcatgtttggcctttggaagaatagcaatcaa |
7495100 |
T |
 |
| Q |
227 |
ctccttggaggaaaggatggaaagtccctcgcatcatatgaccatgaagg |
276 |
Q |
| |
|
||||||||||||||| |||||| | ||| |||||||||||||| |||| |
|
|
| T |
7495099 |
ctccttggaggaaagtttggaaaaccgctcacatcatatgaccatcaagg |
7495050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 61 - 102
Target Start/End: Complemental strand, 7487792 - 7487751
Alignment:
| Q |
61 |
gttgccgagatcaaaggctccctttcttatgttgtgcattgt |
102 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
7487792 |
gttgccgagatcaaaggttcccttgcttatgttgtgcattgt |
7487751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University