View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14534_low_20 (Length: 246)
Name: NF14534_low_20
Description: NF14534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14534_low_20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 246
Target Start/End: Original strand, 52052485 - 52052735
Alignment:
| Q |
8 |
gcttgttgaatattttgattagtaatgatgaagagagaaagagaaactgatcataacactaatagcataaccatggctaaatacttgatgttactttctg |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52052485 |
gcttgttgaatattttgattagtaattatgaagagagaaagagaaactgatcataacactaatagcataaccatggctaaatacttgatgttactttctg |
52052584 |
T |
|
| Q |
108 |
gtggaagtgat------------caagtgaattactcttcaaatttcaacaaccgtgtgtttgagtgcaagacatgtaaaagacaattttcatcgtttca |
195 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52052585 |
gtggaagtgataaaatatttgatcaagtgaattactcttcaaatttcaacaaccgtgtgtttgagtgcaagacatgtaaaagacaattttcatcgtttca |
52052684 |
T |
|
| Q |
196 |
agcgttgggaggacaccgagcgagtcacaagaaaccgaggttgatggagat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52052685 |
agcgttgggaggacaccgagcgagtcacaagaaaccgaggttgatggagat |
52052735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 121
Target Start/End: Complemental strand, 7688043 - 7687991
Alignment:
| Q |
69 |
atagcataaccatggctaaatacttgatgttactttctggtggaagtgatcaa |
121 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||| |||||||||||||| |
|
|
| T |
7688043 |
atagcataaccatggcaaattgtttgatgttactttctcgtggaagtgatcaa |
7687991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University