View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14534_low_22 (Length: 238)
Name: NF14534_low_22
Description: NF14534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14534_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 35628651 - 35628868
Alignment:
| Q |
1 |
ttcaactggggttagagctaaaagaaaatattcacatatgtgacagattattcaatgaccaagagtaagtatttattcattcaaggtcattcacatcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35628651 |
ttcaactggggttagagctaaaagaaagtattcacatatgtgacagattattcaatgaccaagagtaagtatttattcatttaaggtcattcacatcaaa |
35628750 |
T |
 |
| Q |
101 |
ttacataaccacaaactcctttcataaaaattggaaactatagacatttagatttaattccacatacgtagcacaacataaagcagtcaccaactaactt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
35628751 |
ttacataaccacaaactcctttaataaaaattggaaactatagaaatttagatttaattccacatacatagcacagcataaagcagtcaccaactaactt |
35628850 |
T |
 |
| Q |
201 |
tataccattagatgtgca |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35628851 |
tataccattagatgtgca |
35628868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University