View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14534_low_29 (Length: 206)
Name: NF14534_low_29
Description: NF14534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14534_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 41 - 189
Target Start/End: Complemental strand, 44696426 - 44696278
Alignment:
| Q |
41 |
gtcaaattatgaatcctcgtggtgaagacttggctacaccgattcctagtgattctcatcattacttcgccggatcaaataatgttaatcatcatcacaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44696426 |
gtcaaattatgaatcctcgtggtgaagacttggctacaccgattcctagtgattctcatcattacttcgccggatcaaataatgttaatcatcatcgcaa |
44696327 |
T |
 |
| Q |
141 |
ccaatctggtttgtggtttacgctacgctcctttaccaaccggtgagct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44696326 |
ccaatctggtttgtggtttacgctacgctcctttaccaaccggtgagct |
44696278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University