View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14534_low_7 (Length: 415)
Name: NF14534_low_7
Description: NF14534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14534_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 92 - 273
Target Start/End: Complemental strand, 44912229 - 44912046
Alignment:
| Q |
92 |
tttgataattatgaatattattgcttcaaagttattttgtgtagtacttcgttatttgctaagaaaaataggaatacagttggcttatcaattttaatat |
191 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44912229 |
tttgatgattatgaatattattgcttcaaagttattttgtgtagtacttcgttatttgcttagaaaaataggaatacagttggcttatcaattttaatat |
44912130 |
T |
|
| Q |
192 |
tcaaagttcattctcttttaatttgcc--nnnnnnnnaactgtctccaattttatgtagaaataacttatatgagaagaacatt |
273 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44912129 |
tcaaagttcattctcttttaatttgccttttttttttaattgtctccaattttatgtagaaataacttatatgagaagaacatt |
44912046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 154 - 294
Target Start/End: Complemental strand, 44918173 - 44918034
Alignment:
| Q |
154 |
gaaaaataggaatacagttggcttatcaattttaatattcaaagttcattctcttttaatttgccnnnnnnnnaactgtctccaattttatgtagaaata |
253 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| | |||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
44918173 |
gaaaaataggaatattgttgccttatcaatttca-tattcaaagttcattctcttttaatttgccttttattgaactatctccaattttatgttgaaata |
44918075 |
T |
|
| Q |
254 |
acttatatgagaagaacattataattgaataagcaacatat |
294 |
Q |
| |
|
|| ||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
44918074 |
tctcatatgaggagaacatgataattgaatgagcaacatat |
44918034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 44948902 - 44948864
Alignment:
| Q |
1 |
ttcaaatcactattcttgactttatgtctaaaggaaaaa |
39 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44948902 |
ttcaaatcactattctagactttatgtctaaaggaaaaa |
44948864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University