View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14535_low_4 (Length: 412)
Name: NF14535_low_4
Description: NF14535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14535_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 283 - 382
Target Start/End: Original strand, 49223573 - 49223672
Alignment:
| Q |
283 |
ggtgtattggtattgcaaaattacaaataatttgaaacataaaaatattctaaataacacacataatgagacaaagagaataattctcactattggcaag |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49223573 |
ggtgtattggtattgcaaaattacaaataatttgaaacataaaaatattctaaataacacacataatgagacaaagagaataattctcactattggcaag |
49223672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 49223434 - 49223497
Alignment:
| Q |
18 |
aaattaattgcaatttgataaaaacaattaatatcaatgagaataaggtcttaaaatatggtgg |
81 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49223434 |
aaattaattgcaagttgataaaaacaattaatatcaatgagaacaaggtcttaaaatatggtgg |
49223497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 194 - 248
Target Start/End: Original strand, 49223494 - 49223548
Alignment:
| Q |
194 |
gtggagaaagcaaagctgtacgtagaaatcaaatggagaattggcttcttacatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49223494 |
gtggagaaagcaaagctgtacgtagaaatcaaatggagaattggcttcttacatt |
49223548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University