View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_high_15 (Length: 237)
Name: NF14536_high_15
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 52465047 - 52465239
Alignment:
| Q |
18 |
atgaaagcttacttataacactgtcaatgaacactgtaacatgggagaaatatcacgttatcacgttatcacgtctcttcatcagaacaaaatatcttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52465047 |
atgaaagcttacttataacactgtcaatgaacactgtaacatgggagaaatatc--------acgttatcacgtctcttcatcagaacaaaatatcttga |
52465138 |
T |
 |
| Q |
118 |
cccacttgttggtgtactgtatagttctgtcgacatacaacaatacaagtaaagagaatattactccccaatccctactatgtat--cactactttgtac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
52465139 |
cccacttgttggtgtactgtatagttctgtcgacatacaacaatacaggtaaagagaatattactccccaatccctattatgtatcacactactttgtac |
52465238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University