View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_high_17 (Length: 223)
Name: NF14536_high_17
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 42898702 - 42898609
Alignment:
| Q |
1 |
cttttgtcaaaaatattacaatgtgattctaaatgattctgataaattcaccatcaatctaagcatgcactaacaactagagagatagtacatt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42898702 |
cttttgtcaaaaatattacaatgtgattctaaatgattctgataaattcaccatcaatctaagcatgcactaacaactagagagatagtacatt |
42898609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 42898546 - 42898504
Alignment:
| Q |
154 |
atctagctaggtacctgctcctatatcaatatatatcaatgta |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42898546 |
atctagctaggtacctgctcctagatcaatatatatcaatgta |
42898504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University