View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_high_8 (Length: 297)
Name: NF14536_high_8
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 37320530 - 37320244
Alignment:
| Q |
1 |
tccttgcattgatttttaaggagacggtaatgggaggtaagagttcaaaagggtctcggaggagagatgtaaattcatcatcaccatcaacatcatatgg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320530 |
tccttgcattgattttcaaggagacggtaatgggaggtaagagttcaaaagggtctcggaggagagatgtaaattcatcatcaccatcaacatcatatgg |
37320431 |
T |
 |
| Q |
101 |
ctctgttggttcttcttcatcttcatgggaaaataactatggatatccacaatcaacatatccataccctccacagcaaaatccatatcaaaggcctaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320430 |
ctctgttggttcttcttcatcttcatgggaaaataactatggatatccacaatcaacatatccataccctccacagcaaaatccatatcaaaggcctaat |
37320331 |
T |
 |
| Q |
201 |
caccgtccccctacacaggctccctctcatgattattcacggccgaataggaagttggataggagatattcaaggattgctgatgat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320330 |
caccgtccccctacacaggctccctctcatgattattcacggccgaataggaagttggataggagatattcaaggattgctgatgat |
37320244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University