View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_low_10 (Length: 290)
Name: NF14536_low_10
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 24 - 248
Target Start/End: Complemental strand, 3235380 - 3235160
Alignment:
| Q |
24 |
gtgttggttgcacaagtcatgagtgttgatagcactattgttgtcaatatgtttgaagttttgctggtgtttaagtaagtaagtatgaaccaacaagcaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3235380 |
gtgttggttgcacaagtcatgagtgttgatagcactattgttgtcaatatgtttgaagttttgctggtgtttaagtaagta----tgaaccaacaagcaa |
3235285 |
T |
|
| Q |
124 |
cctttcctgtactctttggtcgatttggaaacaaagaaaatgtttgtatttggaagtatgtcacatacttactaacaagatggcaaaatgctaggatcag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3235284 |
cctttcctgtactctttggtcgatttggaaacaaagaaaatgtttgtatttggaactatgtcacatatttactaacaagatggcaaaatgctaggatcag |
3235185 |
T |
|
| Q |
224 |
ccacatgttagtagaagatggaaag |
248 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
3235184 |
ccacatgtaagtagaagatggaaag |
3235160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University