View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_low_14 (Length: 273)
Name: NF14536_low_14
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 48829377 - 48829191
Alignment:
| Q |
1 |
agtgagttctatttatactatatgcgtttgaacacaaatatatgctgaaaatagtgcaaaaatgtgctatgattcaaatcagtcttacaaaaatgaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48829377 |
agtgagttctatttatactatatgcgtttgaacacaaatatatgctgaaaatagtgcaaaaatgtgttatgattcgaatcagtcttacaaaaatgaattc |
48829278 |
T |
 |
| Q |
101 |
taggatctttgcaaaatttgtttcgaatcacaagaagatcgattctattaaatgatttattcatgattcaaatcaaggagtccaataat |
189 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48829277 |
taggatctttg-taaatttgtttcgaatcacaagaagatcgattctatt-aatgatttattcatgattcaaatcaaggagtccaataat |
48829191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 212 - 257
Target Start/End: Complemental strand, 48829192 - 48829147
Alignment:
| Q |
212 |
atcctatttgaatcgatttgtgattttcatcatgattggaatgaac |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48829192 |
atcctatttgaatcgatttgtgattttcaccatgattggaatgaac |
48829147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University