View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_low_15 (Length: 240)
Name: NF14536_low_15
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_low_15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 14474231 - 14474011
Alignment:
| Q |
20 |
gggtatgtactatgctgtccatgtcctgtattttataggactacatcattcactgaacaaaaatcacttcaagaacttattttcaagactatttaacttt |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14474231 |
gggtatgtagtatgctgtccatgtcctgtattttataggactacatcattcactgaacaaaaatcacttcaagaacttattttcaagactatttaacttt |
14474132 |
T |
|
| Q |
120 |
aaggaactcttttatataaccactttcgcatattttctcgtgcacaaactggacttgtataagcttgtagagtattttatgggtgcaagttaacggttat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14474131 |
aaggaactcttttatataaccactttcgcatattttctcatgcacaaactggacttgtataagcttgtagagtattttacaggtgcaagttaacggttat |
14474032 |
T |
|
| Q |
220 |
ttaaaccgtcaacctctttct |
240 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
14474031 |
ttaaaccttcaacctctttct |
14474011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University