View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14536_low_16 (Length: 237)

Name: NF14536_low_16
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14536_low_16
NF14536_low_16
[»] chr3 (1 HSPs)
chr3 (1-221)||(1174325-1174545)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1174325 - 1174545
Alignment:
1 cagctgtattactaagctgcaatgacaacaagaataatattaataagcagagataatttttgccaaactctatgataacaaaagttgttttgcttgcact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1174325 cagctgtattactaagctgcaatgacaacaagaataatattaataagcagagataatttttgccaaactctatgataacaaaagttgttttgcttgcact 1174424  T
101 acaagaaaatcgcagatacggccaaaaacactcgaaaaggcttcatacctcaggaatgataaattttccagtaagcaagcaaacagcaggaagagtacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1174425 acaagaaaatcgcagatacggccaaaaacactcgaaaaggcttcatacctcaggaatgataaattttccagtaagcaagcaaacagcaggaagagtacaa 1174524  T
201 tatgcaaccaaaggtattgat 221  Q
    |||||||||||||||||||||    
1174525 tatgcaaccaaaggtattgat 1174545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University