View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_low_16 (Length: 237)
Name: NF14536_low_16
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1174325 - 1174545
Alignment:
| Q |
1 |
cagctgtattactaagctgcaatgacaacaagaataatattaataagcagagataatttttgccaaactctatgataacaaaagttgttttgcttgcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1174325 |
cagctgtattactaagctgcaatgacaacaagaataatattaataagcagagataatttttgccaaactctatgataacaaaagttgttttgcttgcact |
1174424 |
T |
 |
| Q |
101 |
acaagaaaatcgcagatacggccaaaaacactcgaaaaggcttcatacctcaggaatgataaattttccagtaagcaagcaaacagcaggaagagtacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1174425 |
acaagaaaatcgcagatacggccaaaaacactcgaaaaggcttcatacctcaggaatgataaattttccagtaagcaagcaaacagcaggaagagtacaa |
1174524 |
T |
 |
| Q |
201 |
tatgcaaccaaaggtattgat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1174525 |
tatgcaaccaaaggtattgat |
1174545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University