View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14536_low_5 (Length: 345)
Name: NF14536_low_5
Description: NF14536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14536_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 13 - 326
Target Start/End: Complemental strand, 33537806 - 33537493
Alignment:
| Q |
13 |
aatataaacaagagaagaataaaatatatcctgctctcgaaatctctctctaaaactgaaattatttatgccagagcactattaatcacttaagaggtgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33537806 |
aatataaacaagagaagaataaaatatatcctgctctcgaaatctctctctaaaactgaaattatttatgccagagcactattaatcacttaagaggtgt |
33537707 |
T |
 |
| Q |
113 |
ctattgagctgaaggccctggatctgtgaaggggatatcagttaaggaatcagccttagacgactttcgagttctagaggtctttcttgcggaagaagtt |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33537706 |
ctattgggctgaaggccctggatctgtgaaggggatatcagttaaggaatcagccttagacgactttcgagttctagaggtctttcttgtggaagaagtt |
33537607 |
T |
 |
| Q |
213 |
tccttatccttttcctccgacgatgattttgcctttctgcgagattgttttgtagttgggggcttgctgttttcttcatcttcattggattgacgacttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33537606 |
tccttatccttttcctccgacgatgattttgcctttctgcgagattgttttgtagttgggggcttgctgttttcttcatcttcattggattgacgacttt |
33537507 |
T |
 |
| Q |
313 |
gtcggtgtcgtcga |
326 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33537506 |
gtcggtgtcgtcga |
33537493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University