View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14537_high_10 (Length: 202)
Name: NF14537_high_10
Description: NF14537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14537_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 186
Target Start/End: Complemental strand, 1573765 - 1573597
Alignment:
| Q |
17 |
agactagttgtcttgatttcctgtannnnnnnnnataaataatataaaactgtattgtttaggcaattttggcatggataatgccactattgctgaccca |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573765 |
agactagttgtcttgatttcctgtatttttttt-ataaataatataaaactgtattgtttaggcaattttggcatggataatgccactattgctgaccca |
1573667 |
T |
 |
| Q |
117 |
ctgcttattatagagctcgtagctgaaagttctatactctcatagaagagagaataaattcactcgcctt |
186 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573666 |
ctgcttattatagagctcgtaactgaaagttctatactctcatagaagagagaataaattcactcgcctt |
1573597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 84 - 134
Target Start/End: Complemental strand, 1579699 - 1579649
Alignment:
| Q |
84 |
tttggcatggataatgccactattgctgacccactgcttattatagagctc |
134 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
1579699 |
tttggcattgataatgccactatagctgacccactgcttatcatagagctc |
1579649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University