View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14537_high_11 (Length: 202)
Name: NF14537_high_11
Description: NF14537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14537_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 30804684 - 30804854
Alignment:
| Q |
20 |
ggccagggtgaaataggtaatcttcaaatgtttcacaaattcatcttagtgaacaaatatgaataaaataacnnnnnnnagggaaaatatgaataaaata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30804684 |
ggccagggtgaaataggtaatcttcaaatgtttcacaaattcatcgtagtgaacaaatatgaataaaataactttttttagggaaaatatgaataaaata |
30804783 |
T |
 |
| Q |
120 |
attatttcattaaaagtattttaagatataaaaatttcaagtttattgtggggatgtgcaaaggtaaactt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804784 |
attatttcattaaaagtattttaagatataaaaatttcaagtttattgtggggatgtgcaaaggtaaactt |
30804854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 145
Target Start/End: Original strand, 30801101 - 30801142
Alignment:
| Q |
104 |
aaatatgaataaaataattatttcattaaaagtattttaaga |
145 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30801101 |
aaatatgaataaaataattatttcagtaaaagtattttaaga |
30801142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University