View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14537_high_3 (Length: 353)
Name: NF14537_high_3
Description: NF14537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14537_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 32413208 - 32413070
Alignment:
| Q |
1 |
tctcccctcaaacgtcaaccctaagatattgcattgtagttttatggcttttgattctttctaatgttagatgtttacgtaagagttgtccttgaagaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32413208 |
tctcccctcaaacgtcaaccctaagatattgcattgtagttttatggcttttgattctttctaatgttagatgtttacgtaagagttgtccttgaagaaa |
32413109 |
T |
 |
| Q |
101 |
aaaataactttcttctttgtgaataagagtctctcttgt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32413108 |
aaaataactttcttctttgtgaataagagtctctcttgt |
32413070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 217 - 296
Target Start/End: Complemental strand, 32413008 - 32412928
Alignment:
| Q |
217 |
ctttttgtgcaacaaacaaaatgagaaagagactc-tagtgtggtgtacgtgttaccaatattatttttattgatcgaggc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32413008 |
ctttttgtgcaacaaacaaaatgagaaagagactcctagtgtggtgtacgtgacaccaatattatttttattgatcgaggc |
32412928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University