View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14537_low_13 (Length: 228)
Name: NF14537_low_13
Description: NF14537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14537_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 49814106 - 49813895
Alignment:
| Q |
1 |
ttatcaagttattaacaaaactaccatgatgcttagcagcacaatcaacaacaatgcttcctctccactttcctaccactctccttttaaggtttcaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49814106 |
ttatcaagttattaacaaaactaccatgatgcttagcagcacaatcaacaacaatgcttcctatccactttcctaccattctccttttaaggtttcaact |
49814007 |
T |
 |
| Q |
101 |
tttcttgaccaatgctttctatgcagcaagaagctcttacctgggaaagatatctacatgtacaagtgagttctcggaaccaaaataagtgtagcatgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49814006 |
tttcttgaccaatgctttctatgcagcaagaagctcttacctgggaaagatatctacatgtacaagtgagttctcggaaccaaaataagtgtagcatgca |
49813907 |
T |
 |
| Q |
201 |
ttttcatcttat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
49813906 |
ttttcatcttat |
49813895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University