View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14537_low_15 (Length: 214)
Name: NF14537_low_15
Description: NF14537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14537_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 9798215 - 9798002
Alignment:
| Q |
1 |
agtgtaaaaggaactgaatcttatggtttcaccaaagatcaatatgagtagttggtgaatctgcttcagtgttcatgatctgcagctaatcaatcagcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9798215 |
agtgtaaaaggaactgaatcttatggtttcaccaaagatcaatatgagtagttggtgaatctgcttcagtgttcatgatctgcagctaatcaatcagcat |
9798116 |
T |
 |
| Q |
101 |
cttctagcaaggttaatctagtttcacatgttacatcaggtataacaaagttctcttattccttgaatcactcaaatattggatcatggattgtggattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9798115 |
cttctagcaaggttaatctagtttcacatgttacatcaggtataacaaagttctcttattccttgaatcactcaaatattggatcatggattgtggattc |
9798016 |
T |
 |
| Q |
201 |
tggtgcaagtgacc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9798015 |
tggtgcaagtgacc |
9798002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University