View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14537_low_8 (Length: 258)
Name: NF14537_low_8
Description: NF14537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14537_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 27449200 - 27449415
Alignment:
| Q |
16 |
aaacacacacagaataagctcttaattgtacaaaaataaagtaaaatattcttgttggattccttaacaagactattactgttgctggtgagatagttgg |
115 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||||| ||||| |||||||| |||||||||||||||| || | |||||||||||| |||||||||||| |
|
|
| T |
27449200 |
aaacacacacaagataagctcttagttgcacaaaaaaaaagttcaatattctagttggattccttaacatgattgttactgttgctgatgagatagttgg |
27449299 |
T |
|
| Q |
116 |
tttgaaaagcatagcagcatactactttggcctagacatcaatacaaaggtgactaaaaaggaagctgaggaaggtctgcagcaggtgttagctggtgag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27449300 |
tttgaaaagcatagcagcatactactttggcctagacatcaatacaaaggtgactaaaaaggaagctgaggaaggtctgcagcaggtgttagctggtgag |
27449399 |
T |
|
| Q |
216 |
tagagaatgaaaattg |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27449400 |
tagagaatgaaaattg |
27449415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 193
Target Start/End: Original strand, 27424458 - 27424534
Alignment:
| Q |
117 |
ttgaaaagcatagcagcatactactttggcctagacatcaatacaaaggtgactaaaaaggaagctgaggaaggtct |
193 |
Q |
| |
|
|||||||||||||| |||||| | |||||| || ||||||||||| |||||| ||||||| |||||||| ||||| |
|
|
| T |
27424458 |
ttgaaaagcatagctgcataccgcagtggccttgaaatcaatacaaatgtgactgaaaaggatgctgaggagggtct |
27424534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University