View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14538_low_5 (Length: 232)
Name: NF14538_low_5
Description: NF14538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14538_low_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 56401813 - 56402037
Alignment:
| Q |
8 |
agattatactataaagtagaaccatcaagtattatatgatgtgaatgagttgtattggccactggctagtatacctacaagaccgttgaatgtttctttt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56401813 |
agatcatactataaagtagaaccatcaagtattatatgatgtgaatgagttgtattggccactggctagtatacctacaagacccttgaatgtttctttt |
56401912 |
T |
|
| Q |
108 |
ataattttcatccttttgatacttcttagttgcagctgaaaaatatgctatgttcaaggggaaaagagaactttgatccttgtgtctttagataatgttt |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401913 |
ataattttcatcattttgatacttcttagttgcagctgaaaaatatgctttgttcaaggggaaaagagaactttgatccttgtgtctttagataatgttt |
56402012 |
T |
|
| Q |
208 |
ttatgcgttttagatgtaatttcat |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
56402013 |
ttatgcgttttagatgtaatttcat |
56402037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 184
Target Start/End: Complemental strand, 11319416 - 11319332
Alignment:
| Q |
99 |
gtttcttttataattttcatccttttgatacttcttagttgcagctgaaaaatatgctatgttcaaggggaaaagagaactttgat |
184 |
Q |
| |
|
||||||| |||| ||||| || ||||||| ||||||||||||||||||| |||||| ||||| | ||||||| |||||| |||| |
|
|
| T |
11319416 |
gtttcttctatagttttcttcattttgatgtttcttagttgcagctgaaatgtatgctttgttc-atgggaaaatagaactctgat |
11319332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 184
Target Start/End: Complemental strand, 11477437 - 11477353
Alignment:
| Q |
99 |
gtttcttttataattttcatccttttgatacttcttagttgcagctgaaaaatatgctatgttcaaggggaaaagagaactttgat |
184 |
Q |
| |
|
||||||| |||| ||||| || ||||||| ||||||||||||||||||| |||||| ||||| | ||||||| |||||| |||| |
|
|
| T |
11477437 |
gtttcttctatagttttcttcattttgatgtttcttagttgcagctgaaatgtatgctttgttc-atgggaaaatagaactctgat |
11477353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University