View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14539_high_2 (Length: 357)

Name: NF14539_high_2
Description: NF14539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14539_high_2
NF14539_high_2
[»] chr8 (1 HSPs)
chr8 (54-107)||(22552201-22552254)
[»] chr4 (1 HSPs)
chr4 (228-256)||(33962309-33962337)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 54 - 107
Target Start/End: Complemental strand, 22552254 - 22552201
Alignment:
54 ggcgttggggttacgactgcgactgcagcgtttgttgcggtggttggaagggga 107  Q
    |||||||||||||||||| ||||  |  ||||||||||||||||||||||||||    
22552254 ggcgttggggttacgactacgacgacgacgtttgttgcggtggttggaagggga 22552201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 256
Target Start/End: Complemental strand, 33962337 - 33962309
Alignment:
228 aaaaaatgggggagattgcagcatttgtt 256  Q
    |||||||||||||||||||||||||||||    
33962337 aaaaaatgggggagattgcagcatttgtt 33962309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University