View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1453_high_11 (Length: 327)
Name: NF1453_high_11
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1453_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 19 - 318
Target Start/End: Original strand, 14528383 - 14528682
Alignment:
| Q |
19 |
gaaagccttcttgtatatgaatttatgcctaacagaagtcttgatcgcttcatttttggtaatttatgaactcatgcagtaatttagacaactaactcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14528383 |
gaaagccttcttgtatatgaatttatgcctaacagaagtcttgatcgcttcatttttggtaatttatgaactcatgcagtaacttagacaactaactcat |
14528482 |
T |
|
| Q |
119 |
gcttgtttaagctagtgcctcactttgactattaagtgattattagtttaacataatatgaactaaatataacatgtcttatgcatagttacagataaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
14528483 |
gcttgtttaagctagtgcctcactttgactattaagtgattattagtttaacataatatgaactaaatataaagtgtcttatgcataattacagataaaa |
14528582 |
T |
|
| Q |
219 |
acaagggcagagaactaaactgggaaaaaagatatgaaattattattgggacagctgaaggattaatttacctgcatgagaactccaaaatcagaataat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14528583 |
acaagggcagagaactaaactgggaaaaaagatatgaaattattattgggacagctgaaggattagtttacctgcatgagaactccaaaatcagaataat |
14528682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University