View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1453_high_17 (Length: 288)
Name: NF1453_high_17
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1453_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 278
Target Start/End: Complemental strand, 37975632 - 37975375
Alignment:
| Q |
19 |
ccatgtctaactttgcgtatcttaatcaagcaaatcagataattggaaattctcactctcttgtggtattgggatagtaatatgagagttaagtacatac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
37975632 |
ccatgtctaactttgcgtatcttaatcaagcaaatcggataattggaaattctcactctcttgtggtattgggatagtaatatgagagttt--tccatac |
37975535 |
T |
|
| Q |
119 |
atctcaactagtgttcaccccaaattttatatttccacctgtaatgcatggagactatgtaaaaatatctagctttgaaaatatgtgcaaaaattatatc |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37975534 |
atctcaactaaggttcaccccaaattttatatttccacctgtgatgcatggagactatgtaaaaatatctagctttgaaaatatgtgcaaaaatcatatc |
37975435 |
T |
|
| Q |
219 |
ttggttggttaagagccttagctgaagtcggttaagttttttcaattgtgactccctttg |
278 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
37975434 |
ttggttggttaaaagccttagctgaaatcggttaagttttttcaattgtgactctctttg |
37975375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University