View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1453_high_20 (Length: 271)
Name: NF1453_high_20
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1453_high_20 |
 |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (3 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (4 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (3 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0517 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 151)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 146 - 238
Target Start/End: Original strand, 14496929 - 14497020
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14496929 |
cctcatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta-atttttgatccttgcaaaatattttgttttttaaaa |
14497020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 14488837 - 14488887
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14488837 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
14488887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 7578409 - 7578359
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7578409 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
7578359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 29487989 - 29487939
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29487989 |
ttttgtgatgatttgcatatgtggcacatgatgactgaaccctttttgtag |
29487939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 33526175 - 33526260
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||| |
|
|
| T |
33526175 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatag-tttttggtccttgcaaaatattttgttttttaaaa |
33526260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 10755409 - 10755359
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
10755409 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
10755359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 14238872 - 14238922
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
14238872 |
ttttgtgatgatttgcatacgtggcacctgatgactgaacccattttgtag |
14238922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 15719778 - 15719828
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
15719778 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag |
15719828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 43727308 - 43727258
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43727308 |
ttttgtgatgatttggatacgtggcacatgatgactgaacccattttgtag |
43727258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 18549307 - 18549376
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
18549307 |
aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgacttaacctattttgtag |
18549376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 32418576 - 32418507
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
32418576 |
aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtag |
32418507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 7326206 - 7326254
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
7326206 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7326254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 7420350 - 7420398
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
7420350 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7420398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 8298707 - 8298755
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8298707 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
8298755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 28497374 - 28497422
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
28497374 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
28497422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 35115579 - 35115531
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35115579 |
cacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
35115531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 10873158 - 10873112
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
10873158 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccatttt |
10873112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 148 - 202
Target Start/End: Original strand, 23360490 - 23360544
Alignment:
| Q |
148 |
tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| |||||| ||||||||| |
|
|
| T |
23360490 |
tcacttttgtgatgatttgcacatgtggcatatgatgattgaacctattttgtag |
23360544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 30337044 - 30337094
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
30337044 |
ttttgtgatgatttgcatacgtggtatatgatgactgaacccattttgtag |
30337094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 1163015 - 1163084
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
1163015 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
1163084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 1525929 - 1525982
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
1525929 |
cacttttgtgatgatttgcataagtggcacattataactgaaccaattttgtag |
1525982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 2811561 - 2811610
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
2811561 |
cacttttgtgatgatttgtatacgtggcacatgatgactaaacccatttt |
2811610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 4017022 - 4017075
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
4017022 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
4017075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 4375809 - 4375862
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
4375809 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
4375862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6146829 - 6146776
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
6146829 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
6146776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 10776379 - 10776326
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
10776379 |
cacttttgtgatgattttcatacgtggcacattatgactgaaccaattttgtag |
10776326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19494238 - 19494291
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
19494238 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
19494291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 21125918 - 21125849
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
21125918 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
21125849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 24187670 - 24187739
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |||||||| || |||||||| ||||||||| |
|
|
| T |
24187670 |
aaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaattttgtag |
24187739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 38930421 - 38930474
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
38930421 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
38930474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 40844414 - 40844329
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| || ||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
40844414 |
ttttgtgatgatttgcatacgtggcacatgatgattgagccgattttgtag-tttttggtccttgcaaaatattttgttttttaaaa |
40844329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 42429997 - 42429952
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
42429997 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
42429952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 43477391 - 43477306
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
43477391 |
ttttgtgatgatttgcatacgagtcacatgatgactgaaccgattttgtag-tttttggtccttgcaaaatattttgttttttaaaa |
43477306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 1778684 - 1778732
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
1778684 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaatccattt |
1778732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4473824 - 4473872
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
4473824 |
cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
4473872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9175252 - 9175204
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
9175252 |
cacttttgtgatgatttgcacacatggcacatgatgactgaacccattt |
9175204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13232318 - 13232366
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
13232318 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
13232366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 14847945 - 14847993
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
14847945 |
cacttttgtgatgatttgcacatgtgacacatgatgagtgaacccattt |
14847993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 15931149 - 15931101
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
15931149 |
cacttttgtgatgatttgcacacgtgtcacatgatgactgaacccattt |
15931101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 23939667 - 23939715
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
23939667 |
cacttttgtgatgatttgcacatgtgacacatgatgactgaactcattt |
23939715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 44998145 - 44998097
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
44998145 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaatccattt |
44998097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 2356002 - 2356053
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
2356002 |
cctcacttttgtgatgatttgcacacatgacacatgatgactgaacccattt |
2356053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 7272524 - 7272593
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||| ||| |||| || |||||||| ||||||||| |
|
|
| T |
7272524 |
aaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaattttgtag |
7272593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 7326423 - 7326390
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7326423 |
atggctaaaatatggttttggtccctgcaaatat |
7326390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 8298585 - 8298618
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8298585 |
atggctaaaatatggttttggtccctgcaaatat |
8298618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 13232564 - 13232531
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13232564 |
atggctaaaatatggttttggtccctgcaaatat |
13232531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14495281 - 14495228
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | || |||||||| ||||||||| |
|
|
| T |
14495281 |
cacttttgtgatgatttgcatacgtggcacctaataactgaaccaattttgtag |
14495228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 21509814 - 21509867
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |||||||| |
|
|
| T |
21509814 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccagttttgtag |
21509867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 22650570 - 22650639
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||| ||||||||| || || ||| | ||||||||| |
|
|
| T |
22650570 |
aaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataaccgaatcaattttgtag |
22650639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 27117913 - 27117868
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
27117913 |
ttttgtgatgatttgcacacgtggcacgtgatgactgaacccattt |
27117868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 28398920 - 28398867
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
28398920 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
28398867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 30969719 - 30969686
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30969719 |
atggctaaaatatggttttggtccctgcaaatat |
30969686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 32040270 - 32040201
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||| | || | |||||| ||||||||| |
|
|
| T |
32040270 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaattttgtag |
32040201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 32195383 - 32195452
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || ||||||| ||||||| |||||| ||| |||||||||| |||||| ||||||||| |
|
|
| T |
32195383 |
aaatagtctctgaccccacttttatgatgatatgcatacgtgacacatgatgattgaacctattttgtag |
32195452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 33636442 - 33636495
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || || ||||| ||||||||| |
|
|
| T |
33636442 |
cacttttgtgatgatttgcatacgtggcacattataacagaaccaattttgtag |
33636495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 35346627 - 35346660
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35346627 |
atggctaaaatatggttttggtccctgcaaatat |
35346660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 146 - 191
Target Start/End: Complemental strand, 36044674 - 36044629
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaac |
191 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
36044674 |
cctcacttttgtgatgatttgcacatgtgatacatgatgactgaac |
36044629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 1778563 - 1778595
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1778563 |
tggctaaaatatggttttggtccctgcaaatat |
1778595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 2728598 - 2728566
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2728598 |
tggctaaaatatggttttggtccctgcaaatat |
2728566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 4621234 - 4621186
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
4621234 |
cacttttgtgatgatttgcacacgtcacacatgatgactgaacccattt |
4621186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 7186005 - 7185973
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7186005 |
tggctaaaatatggttttggtccctgcaaatat |
7185973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10540569 - 10540616
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
10540569 |
cacttttgtgatgatttgcacacgtggcacatgatg-ctgaacccattt |
10540616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 13779415 - 13779367
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
13779415 |
cacttttgtgatgatttgcacatgtggcacatgtagactgaactcattt |
13779367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 14489074 - 14489042
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14489074 |
tggctaaaatatggttttggtccctgcaaatat |
14489042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24090239 - 24090287
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||| |||||||||| |
|
|
| T |
24090239 |
cacttttgtgatgatatgcacatgtgacacatgatgaccgaacccattt |
24090287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 29992181 - 29992133
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | ||| |||||||||||||||||||||| |
|
|
| T |
29992181 |
cacttttgtgatgatttacacacgtgacacatgatgactgaacccattt |
29992133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 186
Target Start/End: Complemental strand, 33652438 - 33652398
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgac |
186 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
33652438 |
cctcacttttgtgatgatttgcacacgtggcacatgatgac |
33652398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 34963665 - 34963633
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34963665 |
tggctaaaatatggttttggtccctgcaaatat |
34963633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35097693 - 35097661
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35097693 |
tggctaaaatatggttttggtccctgcaaatat |
35097661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 37536420 - 37536388
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37536420 |
tggctaaaatatggttttggtccctgcaaatat |
37536388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 42132863 - 42132895
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42132863 |
tggctaaaatatggttttggtccctgcaaatat |
42132895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 42132984 - 42133032
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
42132984 |
cacttttgtgatgatttgcacacctggcacatgatgactgaactcattt |
42133032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 42133155 - 42133123
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42133155 |
tggctaaaatatggttttggtccctgcaaatat |
42133123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3512266 - 3512235
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3512266 |
ggctaaaatatggttttggtccctgcaaatat |
3512235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 4710220 - 4710189
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4710220 |
ggctaaaatatggttttggtccctgcaaatat |
4710189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 6146634 - 6146677
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |
|
|
| T |
6146634 |
cacttttgtgatgatttgcatacgtggcacattataactgaacc |
6146677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 7420230 - 7420261
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7420230 |
ggctaaaatatggttttggtccctgcaaatat |
7420261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 8298975 - 8298944
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8298975 |
ggctaaaatatggttttggtccctgcaaatat |
8298944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 9496341 - 9496372
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9496341 |
ggctaaaatatggttttggtccctgcaaatat |
9496372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9496723 - 9496692
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9496723 |
ggctaaaatatggttttggtccctgcaaatat |
9496692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 10337119 - 10337150
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10337119 |
ggctaaaatatggttttggtccctgcaaatat |
10337150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10337449 - 10337418
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10337449 |
ggctaaaatatggttttggtccctgcaaatat |
10337418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10540782 - 10540751
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10540782 |
ggctaaaatatggttttggtccctgcaaatat |
10540751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 11019520 - 11019551
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11019520 |
ggctaaaatatggttttggtccctgcaaatat |
11019551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 11019857 - 11019826
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11019857 |
ggctaaaatatggttttggtccctgcaaatat |
11019826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 11976373 - 11976404
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11976373 |
ggctaaaatatggttttggtccctgcaaatat |
11976404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 11976616 - 11976573
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
11976616 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
11976573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 17073807 - 17073838
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17073807 |
ggctaaaatatggttttggtccctgcaaatat |
17073838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 17574463 - 17574432
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17574463 |
ggctaaaatatggttttggtccctgcaaatat |
17574432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20277692 - 20277723
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20277692 |
ggctaaaatatggttttggtccctgcaaatat |
20277723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20984146 - 20984177
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20984146 |
ggctaaaatatggttttggtccctgcaaatat |
20984177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21064319 - 21064350
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21064319 |
ggctaaaatatggttttggtccctgcaaatat |
21064350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25600230 - 25600261
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25600230 |
ggctaaaatatggttttggtccctgcaaatat |
25600261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25702809 - 25702778
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25702809 |
ggctaaaatatggttttggtccctgcaaatat |
25702778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 27117976 - 27117945
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27117976 |
ggctaaaatatggttttggtccctgcaaatat |
27117945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 28324061 - 28324014
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||| ||||||||||| |
|
|
| T |
28324061 |
acttttgtgatgatttacacacgtggcacatgatgattgaacccattt |
28324014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28346394 - 28346425
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28346394 |
ggctaaaatatggttttggtccctgcaaatat |
28346425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 28346758 - 28346727
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28346758 |
ggctaaaatatggttttggtccctgcaaatat |
28346727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 32725907 - 32725938
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32725907 |
ggctaaaatatggttttggtccctgcaaatat |
32725938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 32726271 - 32726240
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32726271 |
ggctaaaatatggttttggtccctgcaaatat |
32726240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 34963300 - 34963331
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34963300 |
ggctaaaatatggttttggtccctgcaaatat |
34963331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35097328 - 35097359
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35097328 |
ggctaaaatatggttttggtccctgcaaatat |
35097359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 35346998 - 35346967
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35346998 |
ggctaaaatatggttttggtccctgcaaatat |
35346967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 37536086 - 37536117
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37536086 |
ggctaaaatatggttttggtccctgcaaatat |
37536117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 40493072 - 40493115
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |
|
|
| T |
40493072 |
cacttttgtgatgatttgcatacgtggcacattataactgaacc |
40493115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 42430120 - 42430089
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatat |
42430089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 55
Target Start/End: Original strand, 4473704 - 4473734
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaata |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4473704 |
ggctaaaatatggttttggtccctgcaaata |
4473734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 58
Target Start/End: Original strand, 15719655 - 15719689
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
15719655 |
tggctaaaatatggttttagtccctgcaaatatat |
15719689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 16643921 - 16643875
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
16643921 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
16643875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 19963119 - 19963169
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||| | ||||| |||||||| ||||||||| |
|
|
| T |
19963119 |
ttttgtgatgatttgcatacgtggtatatgataactgaaccgattttgtag |
19963169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 24090487 - 24090457
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatat |
24090457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 35143724 - 35143678
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || ||||| ||||| |
|
|
| T |
35143724 |
ttttgtgatgatttgcataagtggcacatgataaccgaaccgatttt |
35143678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 1162907 - 1162940
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
1162907 |
atggctaaaatatggttttagtccctgcaaatat |
1162940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 1408235 - 1408186
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||| || || |||||||| ||||| |
|
|
| T |
1408235 |
cacttttgtgatgatttgcatacgtggcatattataactgaaccaatttt |
1408186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 4375690 - 4375723
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
4375690 |
atggctaaaatatggttttagtccctgcaaatat |
4375723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 4621356 - 4621323
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
4621356 |
atggctaaaatatagttttggtccctgcaaatat |
4621323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 9832435 - 9832390
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| || |||||||| |
|
|
| T |
9832435 |
ttttgtgatgatttacacatgtggcacatgatgaatgtacccattt |
9832390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 16789254 - 16789201
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
16789254 |
cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag |
16789201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 16789371 - 16789338
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
16789371 |
atggctaaaatatggttttagtccctgcaaatat |
16789338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 22917808 - 22917759
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
22917808 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
22917759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 25131228 - 25131281
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
25131228 |
cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag |
25131281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 25702749 - 25702708
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaa |
190 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
25702749 |
cacttttgtgataatttgcacacgtggcacatgatgactgaa |
25702708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 28998053 - 28998020
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
28998053 |
tggctaaaatatgtttttggtccctgcaaatata |
28998020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 33526050 - 33526083
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
33526050 |
atggctaaaatatggttttagtccctgcaaatat |
33526083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 40066597 - 40066662
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
40066597 |
aaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaatttt |
40066662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 1385614 - 1385582
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
1385614 |
ggcttaaatatggttttggtccctgcaaatata |
1385582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 1420501 - 1420469
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
1420501 |
ggctaaaatatgtttttggtccctgcaaatata |
1420469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 1685234 - 1685274
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactga |
189 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| |
|
|
| T |
1685234 |
cacttttgtgatgatttgcatacgtggcacattataactga |
1685274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 7272415 - 7272451
Alignment:
| Q |
20 |
ttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
7272415 |
ttcaaggctaaaatatggttttagtccctgcaaatat |
7272451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 10717121 - 10717153
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
10717121 |
ggctaaaatatgcttttggtccctgcaaatata |
10717153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 10718507 - 10718475
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
10718507 |
ggctaaaatatgcttttggtccctgcaaatata |
10718475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 10776500 - 10776468
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
10776500 |
tggctaaaatatggttttagtccctgcaaatat |
10776468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 10873281 - 10873249
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
10873281 |
tggctaaaatatggttttggtctctgcaaatat |
10873249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 11976733 - 11976705
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatat |
11976705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13155006 - 13155054
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
13155006 |
cacttttgtattgatttgcacacgtggcacatgatgactgaatccattt |
13155054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 13232201 - 13232229
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatat |
13232229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 17074048 - 17074000
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | ||| |||||||||||||||| ||||| |
|
|
| T |
17074048 |
cacttttatgatgatttgcacacgtgacacatgatgactgaactcattt |
17074000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 17574105 - 17574133
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatat |
17574133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 17574222 - 17574270
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | ||| |||||||||||||||| ||||| |
|
|
| T |
17574222 |
cacttttatgatgatttgcacacgtgacacatgatgactgaactcattt |
17574270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20277812 - 20277860
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||| ||||||| ||||| |
|
|
| T |
20277812 |
cacttttgtgatgatttgaacacgtggcacatgataactgaactcattt |
20277860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 21064439 - 21064487
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||| ||||||| ||||| |
|
|
| T |
21064439 |
cacttttgtgatgatttgaacacgtggcacatgataactgaactcattt |
21064487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 23939546 - 23939578
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
23939546 |
tggctaaaatatggttttggtcactgcaaatat |
23939578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24814825 - 24814873
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||| |||||||||| | || |||||||||||||||| |||||| |
|
|
| T |
24814825 |
cacttttgttatgatttgcacacgtagcacatgatgactgaatccattt |
24814873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 25600351 - 25600399
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | || |||||||||||||||| ||||| |
|
|
| T |
25600351 |
cacttttgtgatgatttgcacacatgacacatgatgactgaactcattt |
25600399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 28398755 - 28398787
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
28398755 |
tggctaaaatatggttttagtccctgcaaatat |
28398787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 32195279 - 32195311
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
32195279 |
tggctaaaatatggttttggtccctacaaatat |
32195311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 54
Target Start/End: Complemental strand, 36044791 - 36044763
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaat |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaat |
36044763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 36588222 - 36588254
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
36588222 |
ggctaaaatatgcttttggtccctgcaaatata |
36588254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 38456789 - 38456757
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
38456789 |
ggctaaaatatgcttttggtccctgcaaatata |
38456757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40066821 - 40066789
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
40066821 |
tggctaaaatatggttttagtccctgcaaatat |
40066789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 40844155 - 40844187
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
40844155 |
tggctaaaatatggttttagtccctgcaaatat |
40844187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 175)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 202
Target Start/End: Complemental strand, 45313760 - 45313690
Alignment:
| Q |
132 |
gaaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||| || ||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45313760 |
gaaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacccattttgtag |
45313690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 238
Target Start/End: Complemental strand, 4814798 - 4814694
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttatttt |
232 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4814798 |
aaatagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtag-tttttggtccttgcaaaatattttgtttt |
4814700 |
T |
 |
| Q |
233 |
ttaaaa |
238 |
Q |
| |
|
|||||| |
|
|
| T |
4814699 |
ttaaaa |
4814694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 43440614 - 43440664
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43440614 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
43440664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 3830253 - 3830303
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
3830253 |
ttttgtgatgatttgcatacgtggcacatgatgactgaactcattttgtag |
3830303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 4513499 - 4513449
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
4513499 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
4513449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 15016625 - 15016575
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
15016625 |
ttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtag |
15016575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 30552266 - 30552316
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30552266 |
ttttatgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
30552316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 46186648 - 46186598
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
46186648 |
ttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtag |
46186598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 51759942 - 51759992
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
51759942 |
ttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtag |
51759992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 53701481 - 53701531
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
53701481 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtag |
53701531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 3152008 - 3151939
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
3152008 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
3151939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 8510318 - 8510387
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
8510318 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
8510387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 35565615 - 35565676
Alignment:
| Q |
136 |
tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||| || |||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
35565615 |
tagtctctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35565676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 36732758 - 36732803
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaaccca |
194 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36732758 |
cacttttgtgatgatttgcacatgtggcacatgatgactgaaccca |
36732803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 39436989 - 39436936
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
39436989 |
cacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag |
39436936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 51058709 - 51058758
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
51058709 |
cacttttgtgatgatttgcatatgtgacacatgatgactgaactcatttt |
51058758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 1721207 - 1721255
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
1721207 |
cacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt |
1721255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 2486782 - 2486734
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2486782 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2486734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4034837 - 4034885
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
4034837 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4034885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9262034 - 9261986
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
9262034 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9261986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9596975 - 9596927
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9596975 |
cacttttgagatgatttgcatacgtggcacatgatgactgaacccattt |
9596927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 10778612 - 10778560
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
10778612 |
acttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag |
10778560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 20405103 - 20405055
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
20405103 |
cacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
20405055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20644625 - 20644673
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
20644625 |
cacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt |
20644673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35177375 - 35177423
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
35177375 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35177423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 40277942 - 40277990
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40277942 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40277990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 47114697 - 47114646
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
47114697 |
cctcacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
47114646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 15286382 - 15286332
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
15286382 |
ttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtag |
15286332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 45313874 - 45313832
Alignment:
| Q |
14 |
aataacttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45313874 |
aataactttatggctaaaatatggttttggtccctgcaaatat |
45313832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 50196420 - 50196470
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
50196420 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacacattctgtag |
50196470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 51500564 - 51500514
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| ||||||||||||| |
|
|
| T |
51500564 |
ttttgtgatgatttgcatacgtgacacatgatgactggacccattttgtag |
51500514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 4950248 - 4950195
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
4950248 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
4950195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 7518344 - 7518275
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||| ||| ||||| || |||||| | ||||||||| |
|
|
| T |
7518344 |
aaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaaacaattttgtag |
7518275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 13584123 - 13584176
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
13584123 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
13584176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 19656784 - 19656731
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
19656784 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
19656731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 21159697 - 21159644
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
21159697 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
21159644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 22156049 - 22156102
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
22156049 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
22156102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 28427505 - 28427436
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |||||||| || |||||||| ||||||||| |
|
|
| T |
28427505 |
aaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtag |
28427436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 30130260 - 30130329
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||| ||| ||||| || ||||||| ||||||||| |
|
|
| T |
30130260 |
aaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaattttgtag |
30130329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 37506986 - 37507039
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
37506986 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
37507039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 40370465 - 40370420
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40370465 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40370420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 7957107 - 7957059
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
7957107 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
7957059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 11463361 - 11463313
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
11463361 |
cacttttttgatgatttgcacacgtggcacatgatgactgaacccattt |
11463313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 201
Target Start/End: Original strand, 16123244 - 16123312
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
201 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||| |
|
|
| T |
16123244 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta |
16123312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 30034352 - 30034304
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
30034352 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
30034304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35407559 - 35407607
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
35407559 |
cacttttgtgatgatttgtacaggtggcacatgatgactgaacccattt |
35407607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35533397 - 35533445
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
35533397 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
35533445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 45006006 - 45006054
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
45006006 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
45006054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 146 - 202
Target Start/End: Complemental strand, 53719210 - 53719154
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||||||||| ||||||||||| |
|
|
| T |
53719210 |
cctcacttttgtgatgatttgcacacgtgatacatgatgactgaatccattttgtag |
53719154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 14772332 - 14772383
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgt |
200 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||| |||||||||||||| |
|
|
| T |
14772332 |
cacttttgtgatgatttgtacacgtggcacatgatgattgaacccattttgt |
14772383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 16679847 - 16679796
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
16679847 |
cctcatttttgtgatgatttgcacacgtggcacaagatgactgaacccattt |
16679796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 196
Target Start/End: Original strand, 28418661 - 28418708
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatt |
196 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
28418661 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaatccatt |
28418708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 29678278 - 29678219
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | |||||||| ||||||| ||||||||| |
|
|
| T |
29678278 |
gtctctagccccacttttgtgatgatttgcacacgtggcacaagatgactaaacccattt |
29678219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 38232491 - 38232440
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||||| | | ||| |||||||||||||||||||||| |
|
|
| T |
38232491 |
cctcacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt |
38232440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 18175909 - 18175959
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
18175909 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
18175959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 30268605 - 30268651
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
30268605 |
ttttgtgatgatttgcatacgtgacacatgatgactgaaccgatttt |
30268651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 275561 - 275614
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
275561 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
275614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 4034715 - 4034748
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4034715 |
atggctaaaatatggttttggtccctgcaaatat |
4034748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 10977097 - 10977150
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| || |||||||| ||||||||| |
|
|
| T |
10977097 |
cacttttgtgatgatttgcatacgtggtacattataactgaaccaattttgtag |
10977150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 198
Target Start/End: Complemental strand, 12673902 - 12673837
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
12673902 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
12673837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14633768 - 14633715
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
14633768 |
cacttttgtgaagatttgcatacgtggcacattataactgaaccaattttgtag |
14633715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 15979336 - 15979369
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15979336 |
atggctaaaatatggttttggtccctgcaaatat |
15979369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 20757518 - 20757571
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
20757518 |
cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag |
20757571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 20907338 - 20907285
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
20907338 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
20907285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 26090080 - 26090047
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26090080 |
atggctaaaatatggttttggtccctgcaaatat |
26090047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 27681324 - 27681357
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27681324 |
atggctaaaatatggttttggtccctgcaaatat |
27681357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 34238717 - 34238770
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
34238717 |
cacttttgagatgatttgcatacgtggcacattataactgaaccaattttgtag |
34238770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 39072094 - 39072041
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
39072094 |
cacttttgtgataatttgcatacgtggcacattataactgaaccaattttgtag |
39072041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 39288780 - 39288727
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
39288780 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
39288727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 45161231 - 45161284
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
45161231 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
45161284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 49670719 - 49670666
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
49670719 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
49670666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 52342462 - 52342421
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaa |
190 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
52342462 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaa |
52342421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 3387385 - 3387433
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
3387385 |
cacttttgtgatgatttgcacacttggcacatgatgagtgaacccattt |
3387433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 4035054 - 4035022
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4035054 |
tggctaaaatatggttttggtccctgcaaatat |
4035022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5345570 - 5345522
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |||| |
|
|
| T |
5345570 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
5345522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 9603749 - 9603797
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||| ||||| |
|
|
| T |
9603749 |
cacttttgtgatgatttgcacacgtgtcacatgatgactgaactcattt |
9603797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 19844386 - 19844434
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||| ||||||||||| |
|
|
| T |
19844386 |
cacttttgtgatgatttgcacacgtgacacatgatgagtgaacccattt |
19844434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 20405223 - 20405191
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20405223 |
ggctaaaatatggttttggtccctgcaaatata |
20405191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 22008891 - 22008859
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22008891 |
tggctaaaatatggttttggtccctgcaaatat |
22008859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25610011 - 25609963
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
25610011 |
cacttttctgatgatttgaacacgtggcacatgatgactgaacccattt |
25609963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26089729 - 26089761
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26089729 |
tggctaaaatatggttttggtccctgcaaatat |
26089761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 29686658 - 29686706
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||| ||||||||| |
|
|
| T |
29686658 |
cacttttgtgatgatttgaacacgtggcacatgatgactaaacccattt |
29686706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 30106220 - 30106188
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30106220 |
ggctaaaatatggttttggtccctgcaaatata |
30106188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 193
Target Start/End: Complemental strand, 31480380 - 31480336
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaaccc |
193 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
31480380 |
cacttttgtgataatttgcacacgtggcacatgatgactgaaccc |
31480336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 39820663 - 39820631
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39820663 |
ggctaaaatatggttttggtccctgcaaatata |
39820631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 43441269 - 43441301
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43441269 |
tggctaaaatatggttttggtccctgcaaatat |
43441301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 47005274 - 47005322
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||| |||||||||| |||||||||| |
|
|
| T |
47005274 |
cacttttgtgatgatttgcacacgtggtacatgatgaccgaacccattt |
47005322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 47433868 - 47433836
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47433868 |
ggctaaaatatggttttggtccctgcaaatata |
47433836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 49323781 - 49323813
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49323781 |
tggctaaaatatggttttggtccctgcaaatat |
49323813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 49324027 - 49323983
Alignment:
| Q |
148 |
tcacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
49324027 |
tcacttttgtgataatttgcacacgtggcacatgatgactgaacc |
49323983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 52956580 - 52956532
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | ||| |||||||||||||||||||||| |
|
|
| T |
52956580 |
cacttttgtgatgatttacacacgtgacacatgatgactgaacccattt |
52956532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 53113503 - 53113551
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
53113503 |
cacttttgtgatgatttgcacacatggcacatgatgactgaacctattt |
53113551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 474044 - 474075
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
474044 |
ggctaaaatatggttttggtccctgcaaatat |
474075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 474408 - 474377
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
474408 |
ggctaaaatatggttttggtccctgcaaatat |
474377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1721452 - 1721421
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1721452 |
ggctaaaatatggttttggtccctgcaaatat |
1721421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 8940405 - 8940362
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
8940405 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
8940362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9262155 - 9262124
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9262155 |
ggctaaaatatggttttggtccctgcaaatat |
9262124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9603919 - 9603888
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9603919 |
ggctaaaatatggttttggtccctgcaaatat |
9603888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12740907 - 12740938
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12740907 |
ggctaaaatatggttttggtccctgcaaatat |
12740938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 12741027 - 12741070
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
12741027 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
12741070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12741271 - 12741240
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12741271 |
ggctaaaatatggttttggtccctgcaaatat |
12741240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14772211 - 14772242
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14772211 |
ggctaaaatatggttttggtccctgcaaatat |
14772242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19844581 - 19844550
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19844581 |
ggctaaaatatggttttggtccctgcaaatat |
19844550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21553889 - 21553920
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21553889 |
ggctaaaatatggttttggtccctgcaaatat |
21553920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 22008770 - 22008727
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
22008770 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
22008727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 22016288 - 22016245
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
22016288 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
22016245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25615975 - 25616006
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25615975 |
ggctaaaatatggttttggtccctgcaaatat |
25616006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28552021 - 28552052
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28552021 |
ggctaaaatatggttttggtccctgcaaatat |
28552052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 28552383 - 28552352
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28552383 |
ggctaaaatatggttttggtccctgcaaatat |
28552352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29490743 - 29490712
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29490743 |
ggctaaaatatggttttggtccctgcaaatat |
29490712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 31480136 - 31480167
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31480136 |
ggctaaaatatggttttggtccctgcaaatat |
31480167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 39132906 - 39132875
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39132906 |
ggctaaaatatggttttggtccctgcaaatat |
39132875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 40370589 - 40370558
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatat |
40370558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 40545564 - 40545595
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40545564 |
ggctaaaatatggttttggtccctgcaaatat |
40545595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 45002021 - 45002052
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45002021 |
ggctaaaatatggttttggtccctgcaaatat |
45002052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 45002141 - 45002184
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
45002141 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
45002184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47005154 - 47005185
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47005154 |
ggctaaaatatggttttggtccctgcaaatat |
47005185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 47005519 - 47005488
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47005519 |
ggctaaaatatggttttggtccctgcaaatat |
47005488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47336228 - 47336259
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47336228 |
ggctaaaatatggttttggtccctgcaaatat |
47336259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 47336581 - 47336550
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47336581 |
ggctaaaatatggttttggtccctgcaaatat |
47336550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 47901919 - 47901962
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |
|
|
| T |
47901919 |
cacttttgtgatgatttgcatacgtggcacattataactgaacc |
47901962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 51550082 - 51550113
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51550082 |
ggctaaaatatggttttggtccctgcaaatat |
51550113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 51550446 - 51550415
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51550446 |
ggctaaaatatggttttggtccctgcaaatat |
51550415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 52342195 - 52342226
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52342195 |
ggctaaaatatggttttggtccctgcaaatat |
52342226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 53113443 - 53113474
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53113443 |
ggctaaaatatggttttggtccctgcaaatat |
53113474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 54608518 - 54608549
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54608518 |
ggctaaaatatggttttggtccctgcaaatat |
54608549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 54608863 - 54608832
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54608863 |
ggctaaaatatggttttggtccctgcaaatat |
54608832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 196
Target Start/End: Original strand, 54767291 - 54767338
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatt |
196 |
Q |
| |
|
||||||||||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
54767291 |
cacttttgtgatgatttgctcacgtgacacatgatgactgaacccatt |
54767338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 25610129 - 25610099
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatat |
25610099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 28418899 - 28418869
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatat |
28418869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 199
Target Start/End: Original strand, 29446074 - 29446124
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| |||||| |
|
|
| T |
29446074 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg |
29446124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 30426163 - 30426113
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||| |||| ||||||||| |
|
|
| T |
30426163 |
ttttgtgatgatttgcatatgtgacacattataactaaaccaattttgtag |
30426113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Original strand, 36673083 - 36673121
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgact |
187 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
36673083 |
cacttttgtgatgatttacatacgtggcacatgatgact |
36673121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 36673244 - 36673214
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatat |
36673214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 46901222 - 46901272
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||| ||||||| |||||||||| |
|
|
| T |
46901222 |
ttttttgatgatttgcatacgtgacacatgataactgaactcattttgtag |
46901272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 2486900 - 2486871
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatat |
2486871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 10976976 - 10977009
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
10976976 |
atggctaaaatatggttttagtccctgcaaatat |
10977009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 20612780 - 20612727
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||||||| ||||||||| |
|
|
| T |
20612780 |
cacttttgtgatgatttgcatacgtgacacattataactgaacaaattttgtag |
20612727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 25710769 - 25710700
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| | ||||||||||||||| || ||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
25710769 |
aaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttgtag |
25710700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 26800008 - 26800057
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
26800008 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
26800057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 29955418 - 29955471
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
29955418 |
cacttttgtgatgatttgcattcgtgtcacattataactgaaccaattttgtag |
29955471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 30004572 - 30004625
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
30004572 |
cacttttgtgatgatttgcatgcgtgacacattataactgaaccaattttgtag |
30004625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 252
Target Start/End: Original strand, 32635673 - 32635714
Alignment:
| Q |
211 |
tccttgcaaaatattttattttttaaaatagttcatggcccc |
252 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
32635673 |
tccttgcaaaatattttgttttttaaaatagtccatagcccc |
32635714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 40169534 - 40169481
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| || |||||| | ||||||||| |
|
|
| T |
40169534 |
cacttttgtgatgattcgcatacgtggcacattataactgaatcaattttgtag |
40169481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 40370283 - 40370316
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
40370283 |
atggctaaaatatgattttggtccctgcaaatat |
40370316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 45320861 - 45320808
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || | |||||| ||||||||| |
|
|
| T |
45320861 |
cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag |
45320808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 248
Target Start/End: Original strand, 46724626 - 46724659
Alignment:
| Q |
215 |
tgcaaaatattttattttttaaaatagttcatgg |
248 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
46724626 |
tgcaaaatattttatttttgaaaatagttcatgg |
46724659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 52708677 - 52708644
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
52708677 |
tggctaaaatatgcttttggtccctgcaaatata |
52708644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 863649 - 863621
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatat |
863621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 7957227 - 7957195
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
7957227 |
tggctaaaatatgattttggtccctgcaaatat |
7957195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 8510213 - 8510245
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
8510213 |
tggctaaaatatggttttagtccctgcaaatat |
8510245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 8940522 - 8940494
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatat |
8940494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 9261788 - 9261820
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
9261788 |
tggctaaaatatgattttggtccctgcaaatat |
9261820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 15016387 - 15016419
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
15016387 |
tggctaaaatatggttttagtccctgcaaatat |
15016419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 19844264 - 19844296
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
19844264 |
tggctaaaatatggttttggtccctacaaatat |
19844296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 20644504 - 20644536
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
20644504 |
tggctaaaatatagttttggtccctgcaaatat |
20644536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 20644876 - 20644844
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
20644876 |
ggctaaaatatggttttggtccctgtaaatata |
20644844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 25710871 - 25710839
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
25710871 |
tggctaaaatatggttttagtccctgcaaatat |
25710839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 29678388 - 29678356
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
29678388 |
tggctaaaatatgattttggtccctgcaaatat |
29678356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Original strand, 30128284 - 30128312
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30128284 |
ggctaaaatatggttttggtccctgcaaa |
30128312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 31480501 - 31480469
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
31480501 |
tggctaaaatatggatttggtccctgcaaatat |
31480469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 35565508 - 35565540
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
35565508 |
ggctaaaatatggttttgttccctgcaaatata |
35565540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 35569133 - 35569105
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatat |
35569105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 35936780 - 35936812
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
35936780 |
ggctaaaatatggttttggtccctacaaatata |
35936812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 39132787 - 39132739
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| | |||||||||||||| ||||| |
|
|
| T |
39132787 |
cacttttgtgatgatttgcacacgtgacgcatgatgactgaactcattt |
39132739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40169655 - 40169623
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
40169655 |
tggctaaaatatggttttagtccctgcaaatat |
40169623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 40477433 - 40477401
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
40477433 |
ggctaaaatatgattttggtccctgcaaatata |
40477401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 40979479 - 40979531
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
201 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||||||| |||||||| |
|
|
| T |
40979479 |
cacttttgtgatgatttgcatacgtgtcacattataactgaactaattttgta |
40979531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 44506582 - 44506614
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
44506582 |
ggctaaaatatggttttagtccctgcaaatata |
44506614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 44507858 - 44507826
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
44507858 |
ggctaaaatatgattttggtccctgcaaatata |
44507826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 44802281 - 44802313
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
44802281 |
tggctaaaatatggttttagtccctgcaaatat |
44802313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 46026076 - 46026108
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
46026076 |
ggctaaaatatgtttttggtccctgcaaatata |
46026108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 46104343 - 46104375
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
46104343 |
ggctaaaatatgattttggtccctgcaaatata |
46104375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 53121302 - 53121334
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
53121302 |
ggctaaaatatgtttttggtccctgcaaatata |
53121334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 54437526 - 54437494
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
54437526 |
ggctaaaatatgtttttggtccctgcaaatata |
54437494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 152 - 201
Target Start/End: Original strand, 8453 - 8502
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8453 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
8502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 145)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 22099808 - 22099739
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22099808 |
aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
22099739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 238
Target Start/End: Complemental strand, 29420434 - 29420330
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttatttt |
232 |
Q |
| |
|
||||||||||| || ||||||||||||||| |||||| |||||||||||||| |||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
29420434 |
aaatagtctctaaccccacttttgtgatgatatgcatacgtggcacatgatgattgaacccattttgtag-gaaaaggtccttgcaaaatattttgtttt |
29420336 |
T |
 |
| Q |
233 |
ttaaaa |
238 |
Q |
| |
|
|||||| |
|
|
| T |
29420335 |
ttaaaa |
29420330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 45505770 - 45505724
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45505770 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
45505724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 45593347 - 45593397
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
45593347 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
45593397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 51545848 - 51545798
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
51545848 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
51545798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 32365197 - 32365266
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||| || ||||||||||||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
32365197 |
aaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatggctgaaccgattttgtag |
32365266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 34355067 - 34355136
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
34355067 |
aaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
34355136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 36702119 - 36702172
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
36702119 |
cacttttgtgatgatttgcatacgtggcacattatgactgaaccaattttgtag |
36702172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5203173 - 5203125
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
5203173 |
cacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt |
5203125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5797700 - 5797652
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
5797700 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5797652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 5827775 - 5827823
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
5827775 |
cacttttgtgatgatttgcatatgtggcacatgatgagtgaactcattt |
5827823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 11692881 - 11692929
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
11692881 |
cacttttgtgatgattttcatacgtggcacatgatgactgaacccattt |
11692929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13530499 - 13530547
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
13530499 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
13530547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 24774307 - 24774259
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
24774307 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24774259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25424192 - 25424144
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
25424192 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
25424144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 54208705 - 54208657
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
54208705 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
54208657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 52441882 - 52441932
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
52441882 |
ttttgtgatgatttgcatacgtgacacgtgatgactgaacccattttgtag |
52441932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 4279215 - 4279162
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
4279215 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
4279162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6827754 - 6827701
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
6827754 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
6827701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 16712574 - 16712521
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||| |||| ||||||||| |
|
|
| T |
16712574 |
cacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtag |
16712521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 18830948 - 18831017
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||| ||||| || |||||||| | ||||||| |
|
|
| T |
18830948 |
aaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaactttgtag |
18831017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 25358449 - 25358396
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||||||| |||||||||| |
|
|
| T |
25358449 |
cacttttgtgatgatttgaacacgtggcacatgatgactgaactcattttgtag |
25358396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 34362026 - 34361973
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
34362026 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
34361973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 35415419 - 35415472
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
35415419 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
35415472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 50714446 - 50714393
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
50714446 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
50714393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 2034734 - 2034686
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
2034734 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaatccattt |
2034686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4211621 - 4211669
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
4211621 |
cacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt |
4211669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 7642533 - 7642485
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
7642533 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
7642485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 146 - 194
Target Start/End: Complemental strand, 12791857 - 12791809
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaaccca |
194 |
Q |
| |
|
||||||||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
12791857 |
cctcacttttgtgatgatttgcacacgtgacacatgatgactgaaccca |
12791809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 19903381 - 19903429
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||| |||| |
|
|
| T |
19903381 |
cacttttgtgatgatttgcacatgtggcacatgatgagtgaaccaattt |
19903429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35119383 - 35119431
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
35119383 |
cacttttgtgatgatttgcacacgtggtacatgatgactgaacccattt |
35119431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 36050406 - 36050454
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
36050406 |
cacttttgtgatgatttgcacacgtggcatatgatgactgaacccattt |
36050454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 194
Target Start/End: Original strand, 41439909 - 41439953
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaaccca |
194 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
41439909 |
acttttgtgatgatttgcacacgtggcacatgatgactgaaccca |
41439953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 43200090 - 43200138
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
43200090 |
cacttttgtgatgatttgcacatgtgacatatgatgactgaacccattt |
43200138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 46115659 - 46115611
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
46115659 |
cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
46115611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 46128793 - 46128745
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
46128793 |
cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
46128745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 47022985 - 47022937
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
47022985 |
cacttttttgatgatttgcacacgtggcacatgatgactgaacccattt |
47022937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 50822178 - 50822126
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
50822178 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
50822126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 242
Target Start/End: Complemental strand, 8191264 - 8191177
Alignment:
| Q |
154 |
ttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt |
242 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||| |||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
8191264 |
ttgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag-aaaaaagtccttgcaaaatatattgttttttaaaatagt |
8191177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 13073869 - 13073928
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | |||| |||||||||| |||||||||| |
|
|
| T |
13073869 |
gtctctggccccacttttgtgatgatttgcacacgtggtacatgatgaccgaacccattt |
13073928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 42823982 - 42823923
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| || ||||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
42823982 |
gtctctggccccatttttgtgatgatttgcacatgtgacacatgatgactgaactcattt |
42823923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 244
Target Start/End: Original strand, 46292452 - 46292547
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagttc |
244 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||| || ||||||||||| ||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
46292452 |
cacttttgtgatgatttgcacacgtgacacatgatgactaaatccattttgtagaaaaatagtccctgcaaaatattttgtttttggaaatagttc |
46292547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 47135898 - 47135941
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
47135898 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
47135941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 2180451 - 2180401
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
2180451 |
ttttgtgatgatttgcatacgtgagacatgatgactgaacctattttgtag |
2180401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 6353518 - 6353476
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaac |
191 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6353518 |
cacttttgttatgatttgcacatgtggcacatgatgactgaac |
6353476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 41346096 - 41346046
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
41346096 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
41346046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 41620136 - 41620086
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |||||| |
|
|
| T |
41620136 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
41620086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 51738351 - 51738309
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaac |
191 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
51738351 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaac |
51738309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5063123 - 5063176
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| | || |||||| | ||||||||| |
|
|
| T |
5063123 |
cacttttgtgatgatttgcatatgtggcacgttataactgaatcaattttgtag |
5063176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 13479389 - 13479442
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
13479389 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
13479442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 14488064 - 14488019
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
14488064 |
ttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
14488019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 27008304 - 27008235
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
27008304 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag |
27008235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 31560697 - 31560664
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31560697 |
atggctaaaatatggttttggtccctgcaaatat |
31560664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 42848393 - 42848360
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42848393 |
atggctaaaatatggttttggtccctgcaaatat |
42848360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 46292390 - 46292423
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46292390 |
atggctaaaatatggttttggtccctgcaaatat |
46292423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 51708908 - 51708855
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
51708908 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
51708855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 52017750 - 52017697
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
52017750 |
cacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtag |
52017697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 55482351 - 55482298
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || | |||||| ||||||||| |
|
|
| T |
55482351 |
cacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtag |
55482298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 123774 - 123722
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
123774 |
acttttgtggtgatttgcatacgtggcacattataactgaaccaattttgtag |
123722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 5827654 - 5827686
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5827654 |
tggctaaaatatggttttggtccctgcaaatat |
5827686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 13073758 - 13073790
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13073758 |
tggctaaaatatggttttggtccctgcaaatat |
13073790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 13074125 - 13074093
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13074125 |
ggctaaaatatggttttggtccctgcaaatata |
13074093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 19321860 - 19321828
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19321860 |
tggctaaaatatggttttggtccctgcaaatat |
19321828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 23245230 - 23245262
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23245230 |
tggctaaaatatggttttggtccctgcaaatat |
23245262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 26412585 - 26412553
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26412585 |
tggctaaaatatggttttggtccctgcaaatat |
26412553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 29380728 - 29380776
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
29380728 |
cacttttgtaatgatttgcacacgtggcacatgatgactgaatccattt |
29380776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 31812043 - 31812091
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
31812043 |
cacttttatgatgatttgcacacgtgacacatgatgactgaacccattt |
31812091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35464383 - 35464351
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35464383 |
tggctaaaatatggttttggtccctgcaaatat |
35464351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 41920964 - 41920912
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
41920964 |
acttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
41920912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 42824092 - 42824060
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42824092 |
tggctaaaatatggttttggtccctgcaaatat |
42824060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 46115413 - 46115445
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46115413 |
tggctaaaatatggttttggtccctgcaaatat |
46115445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 46128547 - 46128579
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46128547 |
tggctaaaatatggttttggtccctgcaaatat |
46128579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 51763082 - 51763034
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| || ||||||||||||||||||| |
|
|
| T |
51763082 |
cacttttgtgatgatttgcacacgtgacaaatgatgactgaacccattt |
51763034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 53308069 - 53308037
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
53308069 |
tggctaaaatatggttttggtccctgcaaatat |
53308037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 4211561 - 4211592
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4211561 |
ggctaaaatatggttttggtccctgcaaatat |
4211592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 5827973 - 5827942
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5827973 |
ggctaaaatatggttttggtccctgcaaatat |
5827942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Complemental strand, 6353637 - 6353606
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatata |
6353606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 11693121 - 11693090
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11693121 |
ggctaaaatatggttttggtccctgcaaatat |
11693090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12152154 - 12152185
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12152154 |
ggctaaaatatggttttggtccctgcaaatat |
12152185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12152493 - 12152462
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12152493 |
ggctaaaatatggttttggtccctgcaaatat |
12152462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 13530713 - 13530682
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13530713 |
ggctaaaatatggttttggtccctgcaaatat |
13530682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13631228 - 13631259
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13631228 |
ggctaaaatatggttttggtccctgcaaatat |
13631259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 13631599 - 13631568
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13631599 |
ggctaaaatatggttttggtccctgcaaatat |
13631568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13764613 - 13764644
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatat |
13764644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14487802 - 14487833
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14487802 |
ggctaaaatatggttttggtccctgcaaatat |
14487833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 14488187 - 14488156
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14488187 |
ggctaaaatatggttttggtccctgcaaatat |
14488156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14594206 - 14594237
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14594206 |
ggctaaaatatggttttggtccctgcaaatat |
14594237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 14791806 - 14791775
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14791806 |
ggctaaaatatggttttggtccctgcaaatat |
14791775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 24774045 - 24774076
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24774045 |
ggctaaaatatggttttggtccctgcaaatat |
24774076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25423924 - 25423955
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25423924 |
ggctaaaatatggttttggtccctgcaaatat |
25423955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25424312 - 25424281
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25424312 |
ggctaaaatatggttttggtccctgcaaatat |
25424281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29420537 - 29420506
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29420537 |
ggctaaaatatggttttggtccctgcaaatat |
29420506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 29499182 - 29499213
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29499182 |
ggctaaaatatggttttggtccctgcaaatat |
29499213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 30046792 - 30046761
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30046792 |
ggctaaaatatggttttggtccctgcaaatat |
30046761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 30061133 - 30061102
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30061133 |
ggctaaaatatggttttggtccctgcaaatat |
30061102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35119292 - 35119323
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35119292 |
ggctaaaatatggttttggtccctgcaaatat |
35119323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35464018 - 35464049
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35464018 |
ggctaaaatatggttttggtccctgcaaatat |
35464049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Complemental strand, 37557194 - 37557163
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatata |
37557163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 43231088 - 43231119
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43231088 |
ggctaaaatatggttttggtccctgcaaatat |
43231119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 43231389 - 43231358
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43231389 |
ggctaaaatatggttttggtccctgcaaatat |
43231358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 53915683 - 53915714
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53915683 |
ggctaaaatatggttttggtccctgcaaatat |
53915714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 53916047 - 53916016
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53916047 |
ggctaaaatatggttttggtccctgcaaatat |
53916016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 54903475 - 54903444
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54903475 |
ggctaaaatatggttttggtccctgcaaatat |
54903444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 19675681 - 19675647
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
19675681 |
atggctaaaatatgcttttggtccctgcaaatata |
19675647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 43368586 - 43368632
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||| |||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
43368586 |
ttttatgatgatttgcatacgtggcacataatgaatgaacccatttt |
43368632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 47136170 - 47136140
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatat |
47136140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 58
Target Start/End: Original strand, 50753925 - 50753955
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatat |
50753955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 53717054 - 53717004
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| |||||| |
|
|
| T |
53717054 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg |
53717004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 11285606 - 11285675
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| ||||| | |||||||| | ||||||||||| |
|
|
| T |
11285606 |
aaatagtctctgaccccatttttgtgatgatttgcatacatggcataagatgactggatccattttgtag |
11285675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 18135996 - 18135943
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
18135996 |
cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag |
18135943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 19903653 - 19903624
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatat |
19903624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 22099541 - 22099574
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
22099541 |
atggctaaaatatggttttagtccctgcaaatat |
22099574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 22204054 - 22204087
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
22204054 |
tggctaaaatatgtttttggtccctgcaaatata |
22204087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 24474843 - 24474790
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
24474843 |
cacttttctgatgatttgcatacgtgacacattataactgaaccaattttgtag |
24474790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 27427962 - 27428015
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||| || ||| |||| ||||||||| |
|
|
| T |
27427962 |
cacttttgtgatgatttgcatacgtggcacaatataactaaaccaattttgtag |
27428015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 28197160 - 28197111
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||| |||||||||| | | ||| ||||||||||||||||||||||| |
|
|
| T |
28197160 |
cacttttatgatgatttgtacacgtgacacatgatgactgaacccatttt |
28197111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 28449104 - 28449059
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
28449104 |
ttttgtgatgatttgcatacatggcatatgatgactgaactcattt |
28449059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 34361793 - 34361834
Alignment:
| Q |
15 |
ataacttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
34361793 |
ataaattcaaggctaaaatatggttttagtccctgcaaatat |
34361834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 38054664 - 38054717
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||| | ||||||||| |
|
|
| T |
38054664 |
cacttttgtgatgatttgcatacgtgacacattataactgaatcaattttgtag |
38054717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 42359406 - 42359373
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
42359406 |
tggctaaaatatgtttttggtccctgcaaatata |
42359373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 49123204 - 49123151
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
49123204 |
cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag |
49123151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 50714567 - 50714534
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
50714567 |
atggctaaaatatggttttagtccctgcaaatat |
50714534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 53717176 - 53717143
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
53717176 |
atggctaaaatatggttttagtccctgcaaatat |
53717143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 244
Target Start/End: Complemental strand, 54121680 - 54121647
Alignment:
| Q |
211 |
tccttgcaaaatattttattttttaaaatagttc |
244 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
54121680 |
tccttgcaaaatattttgttttttaaaatagttc |
54121647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 55072509 - 55072558
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
55072509 |
cacttttgcgatgatttgcatacgtggcacattataactgaaccaatttt |
55072558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 5202929 - 5202957
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatat |
5202957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 8191392 - 8191360
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
8191392 |
tggctaaaatatggttttagtccctgcaaatat |
8191360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 8905235 - 8905203
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
8905235 |
tggctaaaatatggttttggtccctgtaaatat |
8905203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 9836943 - 9836991
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | ||| |||||||||||| ||||||||| |
|
|
| T |
9836943 |
cacttttatgatgatttgcacacgtgtcacatgatgactaaacccattt |
9836991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 12152373 - 12152325
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
12152373 |
cacttttgtgatgatttgcactcgtggcacacgatgactgaactcattt |
12152325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 13064276 - 13064328
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || || |||| |||||||| |
|
|
| T |
13064276 |
cacttttgtgatgatttgcatacgtggcacattataacaaaaccaattttgta |
13064328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 14791502 - 14791530
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatat |
14791530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 20144423 - 20144451
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatat |
20144451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26313987 - 26314019
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
26313987 |
tggctaaaatatggttttgatccctgcaaatat |
26314019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 26314110 - 26314158
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| || || | ||||||||||||||||||| |
|
|
| T |
26314110 |
cacttttgtgatgatttgcacatctgcaatatgatgactgaacccattt |
26314158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 29499543 - 29499515
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatat |
29499515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 30060772 - 30060800
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatat |
30060800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35415634 - 35415602
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
35415634 |
tggctaaaatatggttttagtccctgcaaatat |
35415602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 36054155 - 36054119
Alignment:
| Q |
20 |
ttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
36054155 |
ttcaaggctaaaatacggttttggtccctgcaaatat |
36054119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Original strand, 41324769 - 41324797
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41324769 |
ggctaaaatatggttttggtccctgcaaa |
41324797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 42358032 - 42358064
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42358032 |
ggctaaaatatgtttttggtccctgcaaatata |
42358064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 50714239 - 50714271
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
50714239 |
tggctaaaatatggttttagtccctgcaaatat |
50714271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 51545629 - 51545661
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
51545629 |
ggctaaaatatggttttagtccctgcaaatata |
51545661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 52543609 - 52543561
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | ||| ||||||||||||||| |||||| |
|
|
| T |
52543609 |
cacttttctgatgatttgcacacgtgtcacatgatgactgaatccattt |
52543561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 54208822 - 54208794
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatat |
54208794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 176)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 11822125 - 11822210
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
11822125 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag-tttttgatccttgcaaaatattttgttttttaaaa |
11822210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 138 - 202
Target Start/End: Original strand, 18079508 - 18079572
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
18079508 |
gtctctggccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattttgtag |
18079572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 22919804 - 22919854
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22919804 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
22919854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 26191480 - 26191530
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26191480 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
26191530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 16083155 - 16083224
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||| || ||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
16083155 |
aaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
16083224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 33067608 - 33067559
Alignment:
| Q |
153 |
tttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33067608 |
tttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
33067559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 34808316 - 34808401
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34808316 |
ttttgtgatgatttgcatacgtggcacataatgactgaacccattttgtag-tttttggtccctgcaaaatattttattttttaaaa |
34808401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 48609492 - 48609423
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
48609492 |
aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaacccattttgtag |
48609423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 1811149 - 1811099
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
1811149 |
ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag |
1811099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 13770611 - 13770661
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
13770611 |
ttttgtgatgatttgcatacgtggcacatgacgactgaacccattttgtag |
13770661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 18900013 - 18899963
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
18900013 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
18899963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 20756141 - 20756191
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
20756141 |
ttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtag |
20756191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 136 - 198
Target Start/End: Original strand, 22674310 - 22674372
Alignment:
| Q |
136 |
tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
22674310 |
tagtctctggccccacttttgtgatgatttacagttgtggcacatgatgactgaacccatttt |
22674372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 39303874 - 39303824
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
39303874 |
ttttgtgatgatttgcatacgtggcacatgatgactgaatccattttgtag |
39303824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 46868349 - 46868399
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
46868349 |
ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag |
46868399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 24649453 - 24649522
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
24649453 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
24649522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 48955962 - 48955893
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
48955962 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
48955893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10887353 - 10887401
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10887353 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
10887401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16060715 - 16060763
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
16060715 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16060763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24510062 - 24510110
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
24510062 |
cacttttgtgatgatttgcagatgtggcacatgatgactgaacctattt |
24510110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24977899 - 24977947
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
24977899 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24977947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 33234667 - 33234715
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
33234667 |
cacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt |
33234715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 27521691 - 27521748
Alignment:
| Q |
147 |
ctcacttttgtgatgatttgcatatgtggcacatgatgac--tgaacccattttgtag |
202 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
27521691 |
ctcatttttgtgatgatttgcatacgtggcacatgatgacagtgaacccattttgtag |
27521748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 33380009 - 33380059
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||| ||||||||| |
|
|
| T |
33380009 |
ttttgtgatgatttgcatacgtggcacatgatgaccgaaccaattttgtag |
33380059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 37545830 - 37545780
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
37545830 |
ttttgtgataatttgcatacgtgccacatgatgactgaacccattttgtag |
37545780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 149 - 239
Target Start/End: Complemental strand, 48730498 - 48730408
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaat |
239 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||||| ||||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
48730498 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacctattttgtagaaaaatagtcccagcaaaatattttaatttttaaaat |
48730408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 2733287 - 2733356
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
2733287 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
2733356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 12361130 - 12361183
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
12361130 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
12361183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 18302280 - 18302211
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
18302280 |
aaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
18302211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 18473391 - 18473444
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
18473391 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
18473444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 21383221 - 21383274
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
21383221 |
cacttttgtgattatttgcatatgtggcacattataactgaaccaattttgtag |
21383274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 26442781 - 26442728
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| || |||||||| ||||||||| |
|
|
| T |
26442781 |
cacttttgtgatgatttgcatatgtgacacattataactgaaccaattttgtag |
26442728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 32728930 - 32728877
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
32728930 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
32728877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 41358544 - 41358491
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
41358544 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
41358491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 41881213 - 41881266
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||| |||| ||||||||| |
|
|
| T |
41881213 |
cacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtag |
41881266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 45290560 - 45290629
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
45290560 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
45290629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 45368729 - 45368645
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||| ||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
45368729 |
ttttgtgatgatttgcatatgtgtcacacgatgactgaactgattttgtag--tttttatccttgcaaaatattttgttttttaaaa |
45368645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 46183812 - 46183857
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
46183812 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
46183857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 193
Target Start/End: Original strand, 5058845 - 5058889
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaaccc |
193 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5058845 |
cacttttatgatgatttgcacatgtggcacatgatgactgaaccc |
5058889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 12360723 - 12360771
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
12360723 |
cacttttgtgatgatttgcacatgtggcacataatgagtgaacccattt |
12360771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 15466252 - 15466300
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
15466252 |
cacttttgtgatgatttgcacacgtggcacatgatgtctgaacccattt |
15466300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 238
Target Start/End: Complemental strand, 16097703 - 16097615
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||||||||| | |||||||||| ||||||||||||||||| | |||||||| |
|
|
| T |
16097703 |
acttttgtgatgatttccatacgtgacacatgatgactgatctcattttgtagaaaagaagtccttgcaaaatattttgtgttttaaaa |
16097615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 17129964 - 17129916
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
17129964 |
cacttttgtgatgatttgcacacgtggcagatgatgactgaacccattt |
17129916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25658182 - 25658135
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
25658182 |
cacttttgtgatgatttgcaca-gtggcacatgatgactgaacccattt |
25658135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 33045476 - 33045524
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
33045476 |
cacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt |
33045524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 238
Target Start/End: Original strand, 37624807 - 37624895
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||| |||| ||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
37624807 |
acttttgtgatgatttgcacacgtggcacatcatgaatgaatccattttgtagagaaatagtccctgcaaaatattttaatttttaaaa |
37624895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 39747593 - 39747641
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
39747593 |
cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
39747641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 44157922 - 44157874
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
44157922 |
cacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt |
44157874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 7350627 - 7350569
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
7350627 |
gtctctggccccacttttgtgatgatttgca-acgtggcacatgatgactaaacccattt |
7350569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 41738905 - 41738964
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
41738905 |
gtctcttgccccacttttgtaatgatttgcacacgtggcacatgatgactgaacctattt |
41738964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 52254310 - 52254353
Alignment:
| Q |
159 |
atgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
52254310 |
atgatttgcatacgtggcacatgatgactgaaccgattttgtag |
52254353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Original strand, 990206 - 990256
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |||||| |
|
|
| T |
990206 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
990256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 3753332 - 3753378
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
3753332 |
ttttgtgatgatttgcatacgtggtgcatgatgactgaacccatttt |
3753378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 29072620 - 29072705
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||| ||||| |||||||| |||||||| |||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29072620 |
ttttgtgatgattcgcatacgtggcacaagatgactggacccattttgta-atttttggtccctgcaaaatattttattttttaaaa |
29072705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 35005507 - 35005557
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
35005507 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
35005557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 44641316 - 44641266
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |||||| |
|
|
| T |
44641316 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
44641266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 1159721 - 1159668
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||||||||||| | || |||||||| ||||||||| |
|
|
| T |
1159721 |
cacttttatgatgatttgcatatgtggcacgttataactgaaccaattttgtag |
1159668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 3679743 - 3679796
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
3679743 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
3679796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7001777 - 7001724
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||| |||| ||||||||| |
|
|
| T |
7001777 |
cacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtag |
7001724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 10552194 - 10552141
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||| |||| ||||||||| |
|
|
| T |
10552194 |
cacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtag |
10552141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 13260105 - 13260158
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
13260105 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
13260158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 17984577 - 17984524
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
17984577 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
17984524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19622775 - 19622828
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
19622775 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
19622828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 21391259 - 21391206
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
21391259 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
21391206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 24510310 - 24510277
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24510310 |
atggctaaaatatggttttggtccctgcaaatat |
24510277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 26062076 - 26062129
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||| | ||||||||| |
|
|
| T |
26062076 |
cacttttgtgatgatttgcatacgtggcacattataactgaatcaattttgtag |
26062129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 28507238 - 28507283
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
28507238 |
ttttgtgatgatttgcacatgtgacacatgatgactgaactcattt |
28507283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 35056528 - 35056561
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35056528 |
atggctaaaatatggttttggtccctgcaaatat |
35056561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35307991 - 35307938
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
35307991 |
cacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtag |
35307938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4789428 - 4789476
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
4789428 |
cacttttgtgatgatttaaacacgtggcacatgatgactgaacccattt |
4789476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 8364856 - 8364808
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||| ||||| |
|
|
| T |
8364856 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaactcattt |
8364808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 10631163 - 10631195
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10631163 |
tggctaaaatatggttttggtccctgcaaatat |
10631195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 12322971 - 12322939
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12322971 |
tggctaaaatatggttttggtccctgcaaatat |
12322939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 16060886 - 16060854
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16060886 |
tggctaaaatatggttttggtccctgcaaatat |
16060854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 18927897 - 18927945
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||||| |||| |
|
|
| T |
18927897 |
cacttttgtgatgatttacacacgtggcacatgatgactgaaccaattt |
18927945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 19198829 - 19198781
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| || |||||||||| |
|
|
| T |
19198829 |
cacttttgtgatgatttgcacacgtggcacatgataacggaacccattt |
19198781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24653801 - 24653833
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24653801 |
tggctaaaatatggttttggtccctgcaaatat |
24653833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24977777 - 24977809
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24977777 |
tggctaaaatatggttttggtccctgcaaatat |
24977809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 31060786 - 31060818
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31060786 |
tggctaaaatatggttttggtccctgcaaatat |
31060818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 32035675 - 32035627
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||| | | ||| |||||||||||||||||||||| |
|
|
| T |
32035675 |
cacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt |
32035627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 38151213 - 38151181
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38151213 |
tggctaaaatatggttttggtccctgcaaatat |
38151181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 40718109 - 40718141
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40718109 |
tggctaaaatatggttttggtccctgcaaatat |
40718141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40718475 - 40718443
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40718475 |
tggctaaaatatggttttggtccctgcaaatat |
40718443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 41738795 - 41738827
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41738795 |
tggctaaaatatggttttggtccctgcaaatat |
41738827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 45638579 - 45638611
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45638579 |
tggctaaaatatggttttggtccctgcaaatat |
45638611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 49923707 - 49923659
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
49923707 |
cacttttgtgaagatttgcacatgtagcacatgatgactgaacctattt |
49923659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 51986456 - 51986408
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||| |||||| |
|
|
| T |
51986456 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaatccattt |
51986408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3247198 - 3247229
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3247198 |
ggctaaaatatggttttggtccctgcaaatat |
3247229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 7867357 - 7867326
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7867357 |
ggctaaaatatggttttggtccctgcaaatat |
7867326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 8140434 - 8140465
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8140434 |
ggctaaaatatggttttggtccctgcaaatat |
8140465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10631528 - 10631497
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10631528 |
ggctaaaatatggttttggtccctgcaaatat |
10631497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 10887233 - 10887264
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10887233 |
ggctaaaatatggttttggtccctgcaaatat |
10887264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10887598 - 10887567
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10887598 |
ggctaaaatatggttttggtccctgcaaatat |
10887567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12360603 - 12360634
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12360603 |
ggctaaaatatggttttggtccctgcaaatat |
12360634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12360968 - 12360937
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12360968 |
ggctaaaatatggttttggtccctgcaaatat |
12360937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 200
Target Start/End: Complemental strand, 15335175 - 15335124
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||| |
|
|
| T |
15335175 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt |
15335124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 15516582 - 15516613
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15516582 |
ggctaaaatatggttttggtccctgcaaatat |
15516613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 15526362 - 15526331
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15526362 |
ggctaaaatatggttttggtccctgcaaatat |
15526331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 16026818 - 16026775
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
16026818 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
16026775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 16026938 - 16026907
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16026938 |
ggctaaaatatggttttggtccctgcaaatat |
16026907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 18208802 - 18208849
Alignment:
| Q |
148 |
tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccat |
195 |
Q |
| |
|
||||||||||||||||||||| | |||||| | ||||||||||||||| |
|
|
| T |
18208802 |
tcacttttgtgatgatttgcacacgtggcagaggatgactgaacccat |
18208849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19720712 - 19720743
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19720712 |
ggctaaaatatggttttggtccctgcaaatat |
19720743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 24507843 - 24507812
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24507843 |
ggctaaaatatggttttggtccctgcaaatat |
24507812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 24654167 - 24654136
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24654167 |
ggctaaaatatggttttggtccctgcaaatat |
24654136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 29688313 - 29688270
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| |
|
|
| T |
29688313 |
cacttttgtgatgatttgcatacgtggcacattataactgaacc |
29688270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 30322929 - 30322960
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30322929 |
ggctaaaatatggttttggtccctgcaaatat |
30322960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 32035788 - 32035757
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32035788 |
ggctaaaatatggttttggtccctgcaaatat |
32035757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 33000305 - 33000336
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatat |
33000336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 33000549 - 33000506
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
33000549 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
33000506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 33000669 - 33000638
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33000669 |
ggctaaaatatggttttggtccctgcaaatat |
33000638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 33045690 - 33045659
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33045690 |
ggctaaaatatggttttggtccctgcaaatat |
33045659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 33234546 - 33234577
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33234546 |
ggctaaaatatggttttggtccctgcaaatat |
33234577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 36912853 - 36912884
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36912853 |
ggctaaaatatggttttggtccctgcaaatat |
36912884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 38150968 - 38151011
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
38150968 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
38151011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 38164295 - 38164264
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38164295 |
ggctaaaatatggttttggtccctgcaaatat |
38164264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 39747835 - 39747804
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39747835 |
ggctaaaatatggttttggtccctgcaaatat |
39747804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 42482979 - 42483010
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42482979 |
ggctaaaatatggttttggtccctgcaaatat |
42483010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 42483211 - 42483168
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
42483211 |
cacttttgtgatgatttgcacacgtgtcacatgatgactgaacc |
42483168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 42483271 - 42483240
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42483271 |
ggctaaaatatggttttggtccctgcaaatat |
42483240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 45380272 - 45380303
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45380272 |
ggctaaaatatggttttggtccctgcaaatat |
45380303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 45638894 - 45638863
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45638894 |
ggctaaaatatggttttggtccctgcaaatat |
45638863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47819232 - 47819263
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47819232 |
ggctaaaatatggttttggtccctgcaaatat |
47819263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 47819596 - 47819565
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47819596 |
ggctaaaatatggttttggtccctgcaaatat |
47819565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 155 - 202
Target Start/End: Original strand, 49226361 - 49226408
Alignment:
| Q |
155 |
tgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
49226361 |
tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
49226408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 11711314 - 11711280
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
11711314 |
atggctaaaatatgtttttggtccctgcaaatata |
11711280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Original strand, 15058419 - 15058449
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatat |
15058449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 23470030 - 23469996
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
23470030 |
atggctaaaatatgtttttggtccctgcaaatata |
23469996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 37396901 - 37396867
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
37396901 |
atggctaaaatatgcttttggtccctgcaaatata |
37396867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 53
Target Start/End: Complemental strand, 39025383 - 39025353
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39025383 |
atggctaaaatatggttttggtccctgcaaa |
39025353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Original strand, 44157696 - 44157726
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatat |
44157726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 4323948 - 4323997
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| || |||||||| ||||| |
|
|
| T |
4323948 |
cacttttgtgatgatttgtatacgtggcacattataactgaaccaatttt |
4323997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 4789310 - 4789339
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatat |
4789339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 14007606 - 14007659
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| || |||||| | ||||||||| |
|
|
| T |
14007606 |
cacttttgtgatgatttgtatacgtggcacattataactgaatcaattttgtag |
14007659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 15211860 - 15211827
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
15211860 |
atggctaaaatatggttttggtccttgcaaatat |
15211827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 17130081 - 17130052
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatat |
17130052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 19720954 - 19720913
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaa |
190 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
19720954 |
cacttttgtgataatttgcacacgtggcacatgatgactgaa |
19720913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 26191736 - 26191703
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
26191736 |
atggctaaaatatggttttagtccctgcaaatat |
26191703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 31061151 - 31061118
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
31061151 |
ggctaaaatatggttttgatccctgcaaatatat |
31061118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 31258459 - 31258508
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
31258459 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
31258508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 32454171 - 32454118
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
32454171 |
cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag |
32454118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 32626774 - 32626721
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||| |||| |||||||| || |||||||| ||||||||| |
|
|
| T |
32626774 |
cacttttgtgatgatttacatacgtggcacaatataactgaaccaattttgtag |
32626721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 33234914 - 33234881
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
33234914 |
atggctaaaatatgattttggtccctgcaaatat |
33234881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 34383065 - 34383118
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
34383065 |
cacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtag |
34383118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 242
Target Start/End: Original strand, 39025169 - 39025262
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt |
242 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||||||| ||| ||| |||||||||||||| |||| |||||||| |
|
|
| T |
39025169 |
cacttttgtgatgatttgcactcgtgacacatgatgaccgaacccatttattagaaaaatagtccctgcaaaatattttacttttgaaaatagt |
39025262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 46183686 - 46183715
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatat |
46183715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 3247559 - 3247531
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatat |
3247531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 7001898 - 7001866
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
7001898 |
tggctaaaatatggttttagtccctgcaaatat |
7001866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 7818978 - 7818934
Alignment:
| Q |
154 |
ttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
7818978 |
ttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
7818934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 9774947 - 9774915
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
9774947 |
ggctaaaatatgcttttggtccctgcaaatata |
9774915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 12322603 - 12322635
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
12322603 |
tggctaaaatatggttttgatccctgcaaatat |
12322635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 12322725 - 12322773
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| | |||||| |||| |
|
|
| T |
12322725 |
cacttttatgatgatttgcacatgtggcacatgataattgaaccaattt |
12322773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 17977618 - 17977586
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
17977618 |
ggcttaaatatggttttggtccctgcaaatata |
17977586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 20723747 - 20723715
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
20723747 |
ggctaaaatatgtttttggtccctgcaaatata |
20723715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 20948754 - 20948786
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
20948754 |
tggctaaaatatggttttggtccctacaaatat |
20948786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 22953557 - 22953525
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
22953557 |
tggctaaaatatggttttagtccctgcaaatat |
22953525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24507478 - 24507510
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
24507478 |
tggctaaaatatggttttgatccctgcaaatat |
24507510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24649349 - 24649381
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
24649349 |
tggctaaaatatggttttagtccctgcaaatat |
24649381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 25658013 - 25658045
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
25658013 |
tggctaaaatatggttttggtccccgcaaatat |
25658045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26191358 - 26191390
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
26191358 |
tggctaaaatatggttttagtccctgcaaatat |
26191390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 27262908 - 27262940
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
27262908 |
ggctaaaatatgtttttggtccctgcaaatata |
27262940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 27264275 - 27264243
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
27264275 |
ggctaaaatatgattttggtccctgcaaatata |
27264243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 29072863 - 29072831
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
29072863 |
tggctaaaatatggttttagtccctgcaaatat |
29072831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 34002695 - 34002735
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactga |
189 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
34002695 |
cacttttgtgacgatttgcacacgtggcacatgatgactga |
34002735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 35307710 - 35307746
Alignment:
| Q |
20 |
ttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
35307710 |
ttcaaggctaaaatatggttttagtccctgcaaatat |
35307746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35308112 - 35308080
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
35308112 |
tggctaaaatatggttttagtccctgcaaatat |
35308080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 35721101 - 35721133
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
35721101 |
ggctaaaatatgtttttggtccctgcaaatata |
35721133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 35911947 - 35911915
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
35911947 |
ggctaaaatatgcttttggtccctgcaaatata |
35911915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 37395633 - 37395665
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
37395633 |
ggctaaaatatgtttttggtccctgcaaatata |
37395665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 38136982 - 38136950
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38136982 |
tggctaaaatatgattttggtccctgcaaatat |
38136950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 38150851 - 38150879
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatat |
38150879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 38163934 - 38163962
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatat |
38163962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 39025112 - 39025140
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatat |
39025140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 45380637 - 45380605
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45380637 |
tggctaaaatatgattttggtccctgcaaatat |
45380605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 45979555 - 45979523
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
45979555 |
ggctaaaatatgtttttggtccctgcaaatata |
45979523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 48956067 - 48956035
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
48956067 |
tggctaaaatatggttttagtccctgcaaatat |
48956035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 52254480 - 52254448
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
52254480 |
tggctaaaatatggttttagtccctgcaaatat |
52254448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 94180 - 94230
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
94180 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
94230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 345956 - 345924
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
345956 |
ggctaaaatatgtttttggtccctgcaaatata |
345924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 376428 - 376396
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
376428 |
ggctaaaatatgcttttggtccctgcaaatata |
376396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 146)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 19757872 - 19757922
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19757872 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
19757922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 24954048 - 24953979
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
24954048 |
aaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacctattttgtag |
24953979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 145 - 202
Target Start/End: Complemental strand, 38186646 - 38186589
Alignment:
| Q |
145 |
gcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
38186646 |
gcctcacttttgtgatgatttgcacacgtgacacatgatgactgaacccattttgtag |
38186589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 41054056 - 41054008
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41054056 |
cacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt |
41054008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 238
Target Start/End: Original strand, 45671328 - 45671419
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
45671328 |
cctcatttttgtgatgatttgcatacgtgacacatgatgactgaactcattttgtag-ttttttgtccttgtaaaatattttattttttaaaa |
45671419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 10358125 - 10358175
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
10358125 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtag |
10358175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 13769893 - 13769943
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
13769893 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag |
13769943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 19465740 - 19465790
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
19465740 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
19465790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 239
Target Start/End: Original strand, 20388396 - 20388482
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaat |
239 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||| ||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
20388396 |
ttttgtgatgatttgcatacgtggcatatgatgactgaaccgattttgtag-tttttggtccttgcaaaatattttgttttttaaaat |
20388482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 32189273 - 32189223
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32189273 |
ttttgtgatgatttgcatatatggcacatgatgattgaacccattttgtag |
32189223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 41365094 - 41365044
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41365094 |
ttttgtgatgatttgcatacatggcacatgatgactgaacccattttgtag |
41365044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 46648535 - 46648585
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
46648535 |
ttttgtgatgatttgcgtacgtggcacatgatgactgaacccattttgtag |
46648585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19561267 - 19561320
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
19561267 |
cacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag |
19561320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 21223510 - 21223579
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
21223510 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
21223579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 45073539 - 45073470
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
45073539 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
45073470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 46304279 - 46304210
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
46304279 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
46304210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 48358974 - 48358905
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
48358974 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
48358905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5354998 - 5354950
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
5354998 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5354950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 9659475 - 9659523
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
9659475 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9659523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 11767037 - 11767085
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
11767037 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
11767085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 133 - 201
Target Start/End: Original strand, 14738702 - 14738770
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
201 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| |||||||| |
|
|
| T |
14738702 |
aaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgta |
14738770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 30223581 - 30223629
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
30223581 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
30223629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 39520518 - 39520566
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
39520518 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
39520566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 48852564 - 48852612
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
48852564 |
cacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt |
48852612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 35470159 - 35470112
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
35470159 |
acttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35470112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 31310557 - 31310507
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
31310557 |
ttttgtgatgatttgcatacgtggcacattatgactgaatccattttgtag |
31310507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 488816 - 488885
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
488816 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
488885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 1007110 - 1007057
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
1007110 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
1007057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 3808072 - 3808011
Alignment:
| Q |
136 |
tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||| ||||||||||| |||||||||| |
|
|
| T |
3808072 |
tagtctctgacctcacttttgtgatgatttgcacacgtgacacatgatgaccgaacccattt |
3808011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 5308584 - 5308515
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
5308584 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
5308515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6108578 - 6108525
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
6108578 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
6108525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 7432071 - 7432124
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
7432071 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
7432124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 12894283 - 12894230
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
12894283 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
12894230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 18311683 - 18311752
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || | |||||| ||||||||| |
|
|
| T |
18311683 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtag |
18311752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 145 - 242
Target Start/End: Complemental strand, 19005822 - 19005725
Alignment:
| Q |
145 |
gcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt |
242 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||||||| ||||||||||| ||| ||| |||||||||||||| |||| |||||||| |
|
|
| T |
19005822 |
gcctcacttctgtgatgatttgcacatgtgacacatgatgattgaacccatttattagtaaataggtccctgcaaaatattttacttttgaaaatagt |
19005725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19783934 - 19783987
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
19783934 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
19783987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 21554634 - 21554581
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
21554634 |
cacttttgtgatgttttgcatatgtggcacattataactgaaccaattttgtag |
21554581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 23816932 - 23816863
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || || ||||||||||||||| ||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
23816932 |
aaatagtctctgaccccatttttgtgatgatttgtatacgtggcacatgatgactaaaccgattttgtag |
23816863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 28911697 - 28911750
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||||||||||||| |
|
|
| T |
28911697 |
cacttttgtgatgatttgcatacgtgacacattataactgaacccattttgtag |
28911750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35015100 - 35015047
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
35015100 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
35015047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 39719473 - 39719526
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
39719473 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
39719526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 44403149 - 44403080
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||| | || |||||||| ||||||||| |
|
|
| T |
44403149 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaattttgtag |
44403080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 45021615 - 45021668
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
45021615 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
45021668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 45228707 - 45228752
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
45228707 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
45228752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 242
Target Start/End: Complemental strand, 46759853 - 46759760
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt |
242 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| ||| ||| ||||||||||||| ||||| |||||||| |
|
|
| T |
46759853 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgtttttgaaaatagt |
46759760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 6589081 - 6589129
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
6589081 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
6589129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16940882 - 16940930
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
16940882 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
16940930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 27458519 - 27458567
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
27458519 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
27458567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35104138 - 35104186
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
35104138 |
cacttttgtgatgatttgcacacgtggcacatgatggctgaacccattt |
35104186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35665995 - 35666043
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
35665995 |
cacttttgtgatgatttgcatacgtgacacatgatgactgaactcattt |
35666043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35838044 - 35838092
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| |||||||| |
|
|
| T |
35838044 |
cacttttgtgatgatttgcacacgtggcacatgatgactggacccattt |
35838092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 38486673 - 38486625
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
38486673 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
38486625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 39438909 - 39438861
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
39438909 |
cacttttgtgatgatttgcacatgtgacacatgatgactaaacccattt |
39438861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 44841475 - 44841523
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
44841475 |
cacttttgtgatgatttggacacgtggcacatgatgactgaacccattt |
44841523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 1271490 - 1271431
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| |||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
1271490 |
gtctctagccccacttttgtgataatttgtacacgtggcacatgatgactgaacccattt |
1271431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 27037582 - 27037624
Alignment:
| Q |
14 |
aataacttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
27037582 |
aataattttatggctaaaatatggttttggtccctgcaaatat |
27037624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 30352683 - 30352733
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
30352683 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
30352733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 31732329 - 31732279
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
31732329 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
31732279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 43300730 - 43300780
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||| ||| ||||| |
|
|
| T |
43300730 |
ttttgtaatgatttgcatacgtggcacatgatgactgaacctattgtgtag |
43300780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 18022485 - 18022538
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
18022485 |
cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag |
18022538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 29198303 - 29198336
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29198303 |
ggctaaaatatggttttggtccctgcaaatatat |
29198336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 34877893 - 34877942
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||| |||||||||||| |
|
|
| T |
34877893 |
cacttttgtgatgatttgcacacgcggcacatgatgattgaacccatttt |
34877942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 44508822 - 44508891
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || ||||||||| |||||||||||| ||||||||| || | |||||| ||||||||| |
|
|
| T |
44508822 |
aaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaattttgtag |
44508891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 2945725 - 2945677
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |||| ||||| |
|
|
| T |
2945725 |
cacttttgtgatgatttgcacacgtggcacatgatgaccgaactcattt |
2945677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 3975719 - 3975671
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
3975719 |
cacttttgtaatgatttgcacacgtggcacatgatgactgaactcattt |
3975671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 6589020 - 6589052
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6589020 |
tggctaaaatatggttttggtccctgcaaatat |
6589052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 6892014 - 6892062
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||| | ||||||||||||||||| |
|
|
| T |
6892014 |
cacttttgtgatgatttgcacaggtggcagaagatgactgaacccattt |
6892062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 16853590 - 16853558
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16853590 |
tggctaaaatatggttttggtccctgcaaatat |
16853558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 22540173 - 22540125
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| ||||| ||||| |
|
|
| T |
22540173 |
cacttttgtgatgatttgcacatttggcacatgatgattgaactcattt |
22540125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 31503663 - 31503615
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
31503663 |
cacttttgtgataatttgtacacgtggcacatgatgactgaacccattt |
31503615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 44568326 - 44568358
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44568326 |
ggctaaaatatggttttggtccctgcaaatata |
44568358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1614559 - 1614590
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1614559 |
ggctaaaatatggttttggtccctgcaaatat |
1614590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1614904 - 1614873
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1614904 |
ggctaaaatatggttttggtccctgcaaatat |
1614873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3975549 - 3975580
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3975549 |
ggctaaaatatggttttggtccctgcaaatat |
3975580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3975838 - 3975807
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3975838 |
ggctaaaatatggttttggtccctgcaaatat |
3975807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 5233808 - 5233839
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5233808 |
ggctaaaatatggttttggtccctgcaaatat |
5233839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 8144295 - 8144326
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8144295 |
ggctaaaatatggttttggtccctgcaaatat |
8144326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 8144658 - 8144627
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8144658 |
ggctaaaatatggttttggtccctgcaaatat |
8144627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9659689 - 9659658
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9659689 |
ggctaaaatatggttttggtccctgcaaatat |
9659658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 11767275 - 11767244
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11767275 |
ggctaaaatatggttttggtccctgcaaatat |
11767244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14543710 - 14543741
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14543710 |
ggctaaaatatggttttggtccctgcaaatat |
14543741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 14543799 - 14543846
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| | ||| ||||||||||||||| |||||| |
|
|
| T |
14543799 |
acttttgtgatgatttgcacacgtgacacatgatgactgaatccattt |
14543846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 23399612 - 23399643
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23399612 |
ggctaaaatatggttttggtccctgcaaatat |
23399643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 23399976 - 23399945
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23399976 |
ggctaaaatatggttttggtccctgcaaatat |
23399945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 23676452 - 23676421
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23676452 |
ggctaaaatatggttttggtccctgcaaatat |
23676421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25092160 - 25092191
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25092160 |
ggctaaaatatggttttggtccctgcaaatat |
25092191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25092548 - 25092517
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25092548 |
ggctaaaatatggttttggtccctgcaaatat |
25092517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25988385 - 25988416
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25988385 |
ggctaaaatatggttttggtccctgcaaatat |
25988416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25988749 - 25988718
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25988749 |
ggctaaaatatggttttggtccctgcaaatat |
25988718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 26878071 - 26878040
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26878071 |
ggctaaaatatggttttggtccctgcaaatat |
26878040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 27458399 - 27458430
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27458399 |
ggctaaaatatggttttggtccctgcaaatat |
27458430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28262713 - 28262744
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28262713 |
ggctaaaatatggttttggtccctgcaaatat |
28262744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29198662 - 29198631
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29198662 |
ggctaaaatatggttttggtccctgcaaatat |
29198631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 30709443 - 30709494
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||| |
|
|
| T |
30709443 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt |
30709494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 56
Target Start/End: Original strand, 35469876 - 35469911
Alignment:
| Q |
21 |
tcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35469876 |
tcatggctaaaatatggttttgatccctgcaaatat |
35469911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35837924 - 35837955
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35837924 |
ggctaaaatatggttttggtccctgcaaatat |
35837955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 35838337 - 35838306
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35838337 |
ggctaaaatatggttttggtccctgcaaatat |
35838306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 41053842 - 41053873
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41053842 |
ggctaaaatatggttttggtccctgcaaatat |
41053873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 41054236 - 41054205
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41054236 |
ggctaaaatatggttttggtccctgcaaatat |
41054205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 45228918 - 45228887
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45228918 |
ggctaaaatatggttttggtccctgcaaatat |
45228887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 46759658 - 46759689
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46759658 |
ggctaaaatatggttttggtccctgcaaatat |
46759689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 46828944 - 46828975
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46828944 |
ggctaaaatatggttttggtccctgcaaatat |
46828975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 48192488 - 48192457
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48192488 |
ggctaaaatatggttttggtccctgcaaatat |
48192457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 48852444 - 48852475
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48852444 |
ggctaaaatatggttttggtccctgcaaatat |
48852475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 55
Target Start/End: Complemental strand, 39439029 - 39438999
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaata |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39439029 |
ggctaaaatatggttttggtccctgcaaata |
39438999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 1559587 - 1559538
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
1559587 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
1559538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 1974007 - 1974040
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
1974007 |
atggctaaaatatggttttagtccctgcaaatat |
1974040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 6847117 - 6847088
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatat |
6847088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 6911248 - 6911215
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
6911248 |
tggctaaaatatggttttggttcctgcaaatata |
6911215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 29 - 58
Target Start/End: Original strand, 6954862 - 6954891
Alignment:
| Q |
29 |
aaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatat |
6954891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 19561152 - 19561185
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
19561152 |
atggctaaaatatggttttagtccctgcaaatat |
19561185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35210393 - 35210340
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| || |||||| | ||||||||| |
|
|
| T |
35210393 |
cacttttgtgatgatgtgcatacgtggcacattataactgaatcaattttgtag |
35210340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 37372786 - 37372733
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| || |||||||| ||||||||| |
|
|
| T |
37372786 |
cacttttgtgatgatttgcatacgtgatacattataactgaaccaattttgtag |
37372733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 37952933 - 37952884
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||||| |||| ||||||| |
|
|
| T |
37952933 |
cacttttgtgattatttgcatacgtagcacatgatgattgaatccatttt |
37952884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 44344672 - 44344623
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| || |||||||| ||||| |
|
|
| T |
44344672 |
cacttttgtgatgattttcatacgtggcacattataactgaaccaatttt |
44344623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 45021492 - 45021525
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
45021492 |
atggctaaaatatggttttagtccctgcaaatat |
45021525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 46829314 - 46829281
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
46829314 |
atggctaaaatatggttttgatccctgcaaatat |
46829281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 1006834 - 1006866
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
1006834 |
tggctaaaatatggttttagtccctgcaaatat |
1006866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 5611566 - 5611534
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
5611566 |
ggctaaaatatgattttggtccctgcaaatata |
5611534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 6589271 - 6589243
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatat |
6589243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 6847000 - 6846952
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||| |||||| |
|
|
| T |
6847000 |
cacttttgtgatgatttgcgcacgtggcacatgatgattgaatccattt |
6846952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Complemental strand, 6892260 - 6892232
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6892260 |
ggctaaaatatggttttggtccctgcaaa |
6892232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 7431950 - 7431982
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
7431950 |
tggctaaaatatggttttagtccctgcaaatat |
7431982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 11766920 - 11766948
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatat |
11766948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 12933419 - 12933451
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
12933419 |
ggctaaaatatgcttttggtccctgcaaatata |
12933451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 13769773 - 13769805
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
13769773 |
tggctaaaatatggttttagtccctgcaaatat |
13769805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 16941049 - 16941021
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatat |
16941021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 20355533 - 20355589
Alignment:
| Q |
147 |
ctcacttttgtgatgatttgcatatgtggcacatgatgactgaaccc-attttgtag |
202 |
Q |
| |
|
|||||||||||||||||||| | | ||| |||||||||| ||||||| ||||||||| |
|
|
| T |
20355533 |
ctcacttttgtgatgatttgtacacgtgacacatgatgattgaacccaattttgtag |
20355589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 21223748 - 21223716
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
21223748 |
ggctaaaatatggttttagtccctgcaaatata |
21223716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 23676135 - 23676163
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatat |
23676163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 24195607 - 24195639
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
24195607 |
ggctaaaatatgtttttggtccctgcaaatata |
24195639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 24197162 - 24197130
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
24197162 |
ggctaaaatatgcttttggtccctgcaaatata |
24197130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24717288 - 24717336
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||| |||||||||| | || |||||||||||||||||||||| |
|
|
| T |
24717288 |
cacttttgtaatgatttgcacacatgacacatgatgactgaacccattt |
24717336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 25547491 - 25547459
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
25547491 |
tggctaaaatatggttttagtccctgcaaatat |
25547459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Complemental strand, 27037902 - 27037874
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27037902 |
ggctaaaatatggttttggtccctgcaaa |
27037874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 28262958 - 28262910
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||| |||||||||| ||||| |
|
|
| T |
28262958 |
cacttttgtgatgatttgcacacgtgacacataatgactgaactcattt |
28262910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 28529149 - 28529101
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||| ||||||||| |||||| |
|
|
| T |
28529149 |
cacttttgtgatgatttgcacacgtgacacataatgactgaatccattt |
28529101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 31732100 - 31732132
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
31732100 |
tggctaaaatatggttttagtccctgcaaatat |
31732132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 32197968 - 32197936
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
32197968 |
ggctaaaatatgcttttggtccctgcaaatata |
32197936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 36748197 - 36748229
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
36748197 |
tggctaaaatatgtttttggtccctgcaaatat |
36748229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 37527302 - 37527254
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||| |||||| ||||| |
|
|
| T |
37527302 |
cacttttgtgatgatttgcacacgtgacacatgatgcctgaactcattt |
37527254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 38186369 - 38186397
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatat |
38186397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 44508719 - 44508751
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
44508719 |
tggctaaaatatggttttagtccctgcaaatat |
44508751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 44841711 - 44841683
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatat |
44841683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 48192260 - 48192288
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatat |
48192288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 48359076 - 48359044
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
48359076 |
tggctaaaatatggttttagtccctgcaaatat |
48359044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 7e-18; HSPs: 133)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 3850505 - 3850455
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3850505 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
3850455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 13990728 - 13990813
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13990728 |
ttttgtgatgatttgcatacgtggcacatgatgactcaacccattttgtag-tttttagtccctgcaaaatattttattttttaaaa |
13990813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 3850699 - 3850652
Alignment:
| Q |
155 |
tgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3850699 |
tgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
3850652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 10743933 - 10743883
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
10743933 |
ttttgtgatgatttgcatatgtgtcacatgatgactgaaccgattttgtag |
10743883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 14318279 - 14318229
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
14318279 |
ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag |
14318229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 34125427 - 34125477
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34125427 |
ttttttgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
34125477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7075842 - 7075789
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
7075842 |
cacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag |
7075789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 215 - 256
Target Start/End: Complemental strand, 15141092 - 15141051
Alignment:
| Q |
215 |
tgcaaaatattttattttttaaaatagttcatggccccgctt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15141092 |
tgcaaaatattttattttttaaaatagttcatggccccgctt |
15141051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 238
Target Start/End: Original strand, 17070655 - 17070744
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| |||| ||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
17070655 |
cacttttgtgatgatttgcacacgtggcacatgatgaatgaatccattttgtagaaaaatagtccttgcaaaatattttgatttttaaaa |
17070744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 35167062 - 35166993
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
35167062 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
35166993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5103890 - 5103842
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
5103890 |
cacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt |
5103842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 146 - 202
Target Start/End: Original strand, 21050690 - 21050746
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
21050690 |
cctcacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
21050746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 32108927 - 32108975
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
32108927 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
32108975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 28213482 - 28213541
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
28213482 |
gtctctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
28213541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 28863712 - 28863662
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||||||| |
|
|
| T |
28863712 |
ttttgtgatgatttgcatacgtgtcacatgatgactgaaccgattttgtag |
28863662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 5614410 - 5614357
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
5614410 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5614357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6118375 - 6118322
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
6118375 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
6118322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 15635495 - 15635548
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
15635495 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
15635548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 16616481 - 16616534
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
16616481 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
16616534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 18633841 - 18633788
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
18633841 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
18633788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 26071397 - 26071458
Alignment:
| Q |
136 |
tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||| || |||||||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
26071397 |
tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt |
26071458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 30888280 - 30888333
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || |||||||| ||||||||| |
|
|
| T |
30888280 |
cacttttgtgatgatttgcatatatggcacattataactgaaccaattttgtag |
30888333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 31602267 - 31602320
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| | |||||||||||||||| |
|
|
| T |
31602267 |
cacttttgtgatgatttgcacacgtggcacatgataattgaacccattttgtag |
31602320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35166040 - 35165987
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
35166040 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
35165987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 36577839 - 36577892
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
36577839 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
36577892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 2636789 - 2636837
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
2636789 |
cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
2636837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 4736422 - 4736374
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
4736422 |
cacttttgtgatgatctgcacacgtggcacatgatgactgaacccattt |
4736374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9588492 - 9588444
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9588492 |
cacttttgtgataatttacatacgtggcacatgatgactgaacccattt |
9588444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 28107919 - 28107967
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
28107919 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
28107967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 32888800 - 32888848
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
32888800 |
cacttttgtgatgatttacacacgtggcacatgatgactgaacccattt |
32888848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35609393 - 35609441
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
35609393 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
35609441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 40038615 - 40038663
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
40038615 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacctattt |
40038663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 5904256 - 5904205
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||| || ||||| ||||||||||||| |
|
|
| T |
5904256 |
cctcacttttgtgatgatttgcatacgtgacatatgataactgaacccattt |
5904205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 29855724 - 29855775
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||| |||||||||||||| |
|
|
| T |
29855724 |
cctcacttttgtgatgatttgcacacgcggcacatgacgactgaacccattt |
29855775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 9532312 - 9532362
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| ||| ||||||||||||||| |
|
|
| T |
9532312 |
ttttgtgatgatttgcatacgtgacacatgacgaccgaacccattttgtag |
9532362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 18286531 - 18286589
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaac |
191 |
Q |
| |
|
||||||||||| ||| || |||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
18286531 |
aaatagtctctggccccagttttgtgatgatttacatacgtggcatatgatgactgaac |
18286589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 45136 - 45169
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45136 |
atggctaaaatatggttttggtccctgcaaatat |
45169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 1105025 - 1104980
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
1105025 |
ttttgtgatgatttgcacacgtggcacatgatgattgaacccattt |
1104980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 2217738 - 2217689
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
2217738 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
2217689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5950292 - 5950345
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| || ||||||||| |
|
|
| T |
5950292 |
cacttttgtgatgatttgcatacgtggcacattataactgatccaattttgtag |
5950345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 6912495 - 6912528
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6912495 |
atggctaaaatatggttttggtccctgcaaatat |
6912528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 16038636 - 16038567
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||| ||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
16038636 |
aaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaattttgtag |
16038567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 22551197 - 22551144
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
22551197 |
cacttttgtgatgagctgcatacgtggtacatgatgactgaactcattttgtag |
22551144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 27850257 - 27850204
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
27850257 |
cacttttgtgatggtttgcatacgtggcacattataactgaaccaattttgtag |
27850204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 28550945 - 28550998
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||| || |||||||| ||||||||| |
|
|
| T |
28550945 |
cacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtag |
28550998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 29151636 - 29151689
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
29151636 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
29151689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 29172643 - 29172696
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
29172643 |
cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag |
29172696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 29692973 - 29692920
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
29692973 |
cacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtag |
29692920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 31037499 - 31037564
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
31037499 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
31037564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 37090638 - 37090569
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || ||||||| ||||||||| |
|
|
| T |
37090638 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtag |
37090569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 38496523 - 38496588
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
38496523 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
38496588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 38786261 - 38786329
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| ||| ||||| || |||||| ||||||||||| |
|
|
| T |
38786261 |
aaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaa-ccattttgtag |
38786329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 38962974 - 38962921
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
38962974 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
38962921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 42207360 - 42207413
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
42207360 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
42207413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10830649 - 10830697
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||| ||||||||||||||||| |
|
|
| T |
10830649 |
cacttttgtgatgatttgcacacgtgacacaagatgactgaacccattt |
10830697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 198
Target Start/End: Original strand, 15916403 - 15916454
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| |||| |||||||||||| |
|
|
| T |
15916403 |
cctcacttttgtgatgatttgcacatgtgacacat-atgaatgaacccatttt |
15916454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20690851 - 20690899
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
20690851 |
cacttttgtgatgatttgcatacatggcacatgatgaatgaactcattt |
20690899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35928459 - 35928427
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35928459 |
tggctaaaatatggttttggtccctgcaaatat |
35928427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 36973473 - 36973521
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||| |||||| |
|
|
| T |
36973473 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaatccattt |
36973521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1104858 - 1104889
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1104858 |
ggctaaaatatggttttggtccctgcaaatat |
1104889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1105148 - 1105117
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1105148 |
ggctaaaatatggttttggtccctgcaaatat |
1105117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1381247 - 1381278
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1381247 |
ggctaaaatatggttttggtccctgcaaatat |
1381278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1381611 - 1381580
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1381611 |
ggctaaaatatggttttggtccctgcaaatat |
1381580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 55
Target Start/End: Original strand, 2636668 - 2636699
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaata |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2636668 |
tggctaaaatatggttttggtccctgcaaata |
2636699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 4736542 - 4736511
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4736542 |
ggctaaaatatggttttggtccctgcaaatat |
4736511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 5917126 - 5917157
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5917126 |
ggctaaaatatggttttggtccctgcaaatat |
5917157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 5917460 - 5917429
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5917460 |
ggctaaaatatggttttggtccctgcaaatat |
5917429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 9588358 - 9588389
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9588358 |
ggctaaaatatggttttggtccctgcaaatat |
9588389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 17070535 - 17070566
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17070535 |
ggctaaaatatggttttggtccctgcaaatat |
17070566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 18258162 - 18258193
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18258162 |
ggctaaaatatggttttggtccctgcaaatat |
18258193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 18258527 - 18258496
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18258527 |
ggctaaaatatggttttggtccctgcaaatat |
18258496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19565467 - 19565498
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19565467 |
ggctaaaatatggttttggtccctgcaaatat |
19565498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19565831 - 19565800
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19565831 |
ggctaaaatatggttttggtccctgcaaatat |
19565800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19685017 - 19685048
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19685017 |
ggctaaaatatggttttggtccctgcaaatat |
19685048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 19685136 - 19685179
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
19685136 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
19685179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19685380 - 19685349
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19685380 |
ggctaaaatatggttttggtccctgcaaatat |
19685349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20660948 - 20660979
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20660948 |
ggctaaaatatggttttggtccctgcaaatat |
20660979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20690733 - 20690764
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20690733 |
ggctaaaatatggttttggtccctgcaaatat |
20690764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 20986089 - 20986058
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20986089 |
ggctaaaatatggttttggtccctgcaaatat |
20986058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 24443380 - 24443411
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24443380 |
ggctaaaatatggttttggtccctgcaaatat |
24443411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 24443500 - 24443543
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
24443500 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
24443543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 24443744 - 24443713
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24443744 |
ggctaaaatatggttttggtccctgcaaatat |
24443713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28213373 - 28213404
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28213373 |
ggctaaaatatggttttggtccctgcaaatat |
28213404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 30888160 - 30888191
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatat |
30888191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 32108808 - 32108839
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32108808 |
ggctaaaatatggttttggtccctgcaaatat |
32108839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35876688 - 35876719
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35876688 |
ggctaaaatatggttttggtccctgcaaatat |
35876719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 35877052 - 35877021
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35877052 |
ggctaaaatatggttttggtccctgcaaatat |
35877021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35928064 - 35928095
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35928064 |
ggctaaaatatggttttggtccctgcaaatat |
35928095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 37271586 - 37271543
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
37271586 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
37271543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 37271706 - 37271675
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37271706 |
ggctaaaatatggttttggtccctgcaaatat |
37271675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 38170514 - 38170545
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38170514 |
ggctaaaatatggttttggtccctgcaaatat |
38170545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 40764415 - 40764446
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40764415 |
ggctaaaatatggttttggtccctgcaaatat |
40764446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 56
Target Start/End: Complemental strand, 45507 - 45473
Alignment:
| Q |
22 |
catggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45507 |
catggttaaaatatggttttggtccctgcaaatat |
45473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 2636992 - 2636962
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatat |
2636962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 27916584 - 27916634
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||| ||||||||| ||| || |||||||||||||| ||||||||| |
|
|
| T |
27916584 |
ttttgtgataatttgcatacgtgacagatgatgactgaaccaattttgtag |
27916634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 29875522 - 29875568
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
29875522 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
29875568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 45380 - 45335
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||| ||||||||| |
|
|
| T |
45380 |
ttttgtgatgatttgcacacgtggtacatgatgactaaacccattt |
45335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 294073 - 294024
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
294073 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
294024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 5104003 - 5103970
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
5104003 |
atggctaaaatatggttttggttcctgcaaatat |
5103970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 6912855 - 6912826
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatat |
6912826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 10409050 - 10409103
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
10409050 |
cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag |
10409103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 12145181 - 12145152
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatat |
12145152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 198
Target Start/End: Complemental strand, 18046248 - 18046183
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||| || |||||||||||| ||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
18046248 |
aaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaatttt |
18046183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 21050915 - 21050882
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
21050915 |
atggctaaaatatggttttagtccctgcaaatat |
21050882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 23382190 - 23382137
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || | |||||| ||||||||| |
|
|
| T |
23382190 |
cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag |
23382137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 25561703 - 25561736
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
25561703 |
atggctaaaatatggttttagtccctgcaaatat |
25561736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 35609301 - 35609334
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
35609301 |
atggctaaaatatggttttggtccatgcaaatat |
35609334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 35609635 - 35609606
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatat |
35609606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 38452394 - 38452365
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatat |
38452365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 39379348 - 39379401
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
39379348 |
cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag |
39379401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 40029499 - 40029466
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
40029499 |
atggctaaaatatggttttagtccctgcaaatat |
40029466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 42553640 - 42553673
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
42553640 |
atggctaaaatatgattttggtccctgcaaatat |
42553673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 1286927 - 1286879
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
1286927 |
cacttttgtgatgatttgcaagcgtgacacataatgactgaacccattt |
1286879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 202
Target Start/End: Original strand, 2032735 - 2032775
Alignment:
| Q |
162 |
atttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
2032735 |
atttgcatacgtgacacatgatgactgaacacattttgtag |
2032775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 3936578 - 3936610
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
3936578 |
ggctaaaatatgtttttggtccctgcaaatata |
3936610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 6118500 - 6118468
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
6118500 |
tggctaaaatatggttttagtccctgcaaatat |
6118468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 15916285 - 15916317
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
15916285 |
tggctaaaagatggttttggtccctgcaaatat |
15916317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 18633962 - 18633930
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
18633962 |
tggctaaaatatggttttagtccctgcaaatat |
18633930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20661068 - 20661116
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||| ||||| ||||| |
|
|
| T |
20661068 |
cacttttgtgatgatttgcacacgtgacacatgatgattgaactcattt |
20661116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 20661312 - 20661280
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
20661312 |
tggctaaaatatggttttggtccgtgcaaatat |
20661280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 20985728 - 20985756
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatat |
20985756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 25254188 - 25254156
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatatata |
59 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
25254188 |
ctaaaatatgcttttggtccctgcaaatatata |
25254156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 25317978 - 25317946
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatatata |
59 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
25317978 |
ctaaaatatgcttttggtccctgcaaatatata |
25317946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 27571188 - 27571156
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
27571188 |
ggctaaaatatgattttggtccctgcaaatata |
27571156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 28550826 - 28550858
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
28550826 |
tggctaaaatatggttttagtccctgcaaatat |
28550858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 28863839 - 28863807
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
28863839 |
tggctaaaatatggttttagtccctgcaaatat |
28863807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 29366950 - 29366918
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
29366950 |
tggctaaaatatggttttagtccctgcaaatat |
29366918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 31540496 - 31540528
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
31540496 |
ggctaaaatatgtttttggtccctgcaaatata |
31540528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 33336027 - 33335995
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
33336027 |
tggctaaaatatggttttagtccctgcaaatat |
33335995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 34911887 - 34911855
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
34911887 |
ggctaaaatatgattttggtccctgcaaatata |
34911855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40038859 - 40038827
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
40038859 |
tggctaaaatatgattttggtccctgcaaatat |
40038827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 42596814 - 42596786
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatat |
42596786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 42994067 - 42994099
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
42994067 |
tggctaaaatatggttttagtccctgcaaatat |
42994099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 1540 - 1471
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
1540 |
aaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag |
1471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 110)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 12612255 - 12612186
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
12612255 |
aaatagtctctggctccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag |
12612186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 152 - 240
Target Start/End: Complemental strand, 19275919 - 19275832
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaata |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
19275919 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag-tttttggtccctgcaaaatattttgttttttaaaata |
19275832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 23502294 - 23502345
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23502294 |
cctcaattttgtgatgatttgcacatgtggcacatgatgactgaacccattt |
23502345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 2373371 - 2373321
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
2373371 |
ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag |
2373321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 133 - 199
Target Start/End: Original strand, 14428752 - 14428818
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg |
199 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
14428752 |
aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttg |
14428818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 21995187 - 21995237
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
21995187 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag |
21995237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 23770400 - 23770350
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
23770400 |
ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtag |
23770350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 3414632 - 3414584
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3414632 |
cacttttgtgattatttgcacatgtggcacatgatgactgaacccattt |
3414584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 19320887 - 19320935
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
19320887 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
19320935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 31198735 - 31198783
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
31198735 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
31198783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 6468550 - 6468500
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||||||| |
|
|
| T |
6468550 |
ttttgtgatgatttgcatacgtgacacatgatgactgaaccaattttgtag |
6468500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 9896517 - 9896467
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
9896517 |
ttttatgatgatttgcatacgtggcatatgatgactgaacccattttgtag |
9896467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 33131646 - 33131696
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||||||| |
|
|
| T |
33131646 |
ttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttgtag |
33131696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 777920 - 777867
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
777920 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
777867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 7155916 - 7155969
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
7155916 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
7155969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14655651 - 14655598
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
14655651 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
14655598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 19296287 - 19296234
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||||||| ||||||||| |
|
|
| T |
19296287 |
cacttttgtgatgatttacatatgtggcacattataactgaaccaattttgtag |
19296234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 24273957 - 24274010
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
24273957 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
24274010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 24692878 - 24692809
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| ||||||||| || ||||||| ||||||||| |
|
|
| T |
24692878 |
aaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaactaattttgtag |
24692809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 32885776 - 32885845
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
32885776 |
aaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
32885845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 33801624 - 33801571
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
33801624 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
33801571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 34582649 - 34582702
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
34582649 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
34582702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 12298938 - 12298986
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
12298938 |
cacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt |
12298986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13617649 - 13617697
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
13617649 |
cacttttgtgatgatttgcacacgtggcacatgataactgaacccattt |
13617697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 23629042 - 23628994
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
23629042 |
cacttttgtgatgatttgtacacgtggcacatgatgactgaacccattt |
23628994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 201
Target Start/End: Original strand, 26375795 - 26375863
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
201 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| ||| ||||| || |||||||| |||||||| |
|
|
| T |
26375795 |
aaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta |
26375863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 31185754 - 31185802
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
31185754 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
31185802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 1214815 - 1214862
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
1214815 |
acttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
1214862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 19690516 - 19690563
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
19690516 |
acttttgtgatgatttgcacacgtggcacatgatggctgaacccattt |
19690563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 57
Target Start/End: Original strand, 15442935 - 15442969
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15442935 |
atggctaaaatatggttttggtccctgcaaatata |
15442969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 132 - 198
Target Start/End: Original strand, 15962130 - 15962196
Alignment:
| Q |
132 |
gaaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||| || || |||||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
15962130 |
gaaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
15962196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 317912 - 317981
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
317912 |
aaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
317981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 543604 - 543551
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||||| ||||||||| |
|
|
| T |
543604 |
cacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtag |
543551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 2616116 - 2616063
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
2616116 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
2616063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 8680895 - 8680948
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||| |||| ||||||||| |
|
|
| T |
8680895 |
cacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtag |
8680948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 11129320 - 11129369
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||| |||||||| ||||| |
|
|
| T |
11129320 |
cacttttgtgatgatttgcatacgtggcagatgataactgaaccaatttt |
11129369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 15116791 - 15116844
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
15116791 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
15116844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 17321435 - 17321386
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
17321435 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
17321386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 17321568 - 17321519
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
17321568 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
17321519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 20897557 - 20897524
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20897557 |
tggctaaaatatggttttggtccctgcaaatata |
20897524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 31166989 - 31167042
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
31166989 |
cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag |
31167042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 3276234 - 3276186
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||| |||||||||||| |
|
|
| T |
3276234 |
cacttttgtgatgatttgcacacgtgacacatgatgtctgaacccattt |
3276186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 10910844 - 10910796
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||| ||||||||| |
|
|
| T |
10910844 |
cacttttgtgatgatttacacacgtggcacatgatgactaaacccattt |
10910796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 58
Target Start/End: Original strand, 23628799 - 23628831
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatat |
23628831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24901238 - 24901270
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24901238 |
tggctaaaatatggttttggtccctgcaaatat |
24901270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24901358 - 24901406
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||| ||||||||||||| |
|
|
| T |
24901358 |
cacttttgtgatgatttgcacacgtgacacatgataactgaacccattt |
24901406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 25137113 - 25137161
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| || ||||||||| |
|
|
| T |
25137113 |
cacttttgtgatgatttgcacacgtggcacatgatggctaaacccattt |
25137161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 31398422 - 31398370
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta |
201 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| |||||||| |
|
|
| T |
31398422 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta |
31398370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 56
Target Start/End: Original strand, 34582520 - 34582560
Alignment:
| Q |
16 |
taacttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
34582520 |
taactttatggctaaaatatggttttagtccctgcaaatat |
34582560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1007124 - 1007155
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1007124 |
ggctaaaatatggttttggtccctgcaaatat |
1007155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1007509 - 1007478
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1007509 |
ggctaaaatatggttttggtccctgcaaatat |
1007478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3276354 - 3276323
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3276354 |
ggctaaaatatggttttggtccctgcaaatat |
3276323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3414387 - 3414418
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3414387 |
ggctaaaatatggttttggtccctgcaaatat |
3414418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3968645 - 3968676
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3968645 |
ggctaaaatatggttttggtccctgcaaatat |
3968676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 3968765 - 3968808
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
3968765 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
3968808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3969009 - 3968978
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3969009 |
ggctaaaatatggttttggtccctgcaaatat |
3968978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 176
Target Start/End: Original strand, 5286689 - 5286732
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggc |
176 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||||||||| |
|
|
| T |
5286689 |
aaatagtccctggccccacttttgtgatgatttgcatatgtggc |
5286732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 6412218 - 6412249
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6412218 |
ggctaaaatatggttttggtccctgcaaatat |
6412249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 6412579 - 6412548
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6412579 |
ggctaaaatatggttttggtccctgcaaatat |
6412548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 8170151 - 8170120
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8170151 |
ggctaaaatatggttttggtccctgcaaatat |
8170120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10910964 - 10910933
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10910964 |
ggctaaaatatggttttggtccctgcaaatat |
10910933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12299140 - 12299109
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12299140 |
ggctaaaatatggttttggtccctgcaaatat |
12299109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12757610 - 12757641
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12757610 |
ggctaaaatatggttttggtccctgcaaatat |
12757641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13268109 - 13268140
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13268109 |
ggctaaaatatggttttggtccctgcaaatat |
13268140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 17765009 - 17765040
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17765009 |
ggctaaaatatggttttggtccctgcaaatat |
17765040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 18024131 - 18024178
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
18024131 |
acttttgtgatgatttgcacatgtggcacatgatgcttgaatccattt |
18024178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 18024375 - 18024344
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18024375 |
ggctaaaatatggttttggtccctgcaaatat |
18024344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19321131 - 19321100
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19321131 |
ggctaaaatatggttttggtccctgcaaatat |
19321100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19690393 - 19690424
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19690393 |
ggctaaaatatggttttggtccctgcaaatat |
19690424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 20467718 - 20467687
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20467718 |
ggctaaaatatggttttggtccctgcaaatat |
20467687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21147404 - 21147435
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21147404 |
ggctaaaatatggttttggtccctgcaaatat |
21147435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21385251 - 21385282
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21385251 |
ggctaaaatatggttttggtccctgcaaatat |
21385282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 21385584 - 21385553
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21385584 |
ggctaaaatatggttttggtccctgcaaatat |
21385553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 21994403 - 21994372
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21994403 |
ggctaaaatatggttttggtccctgcaaatat |
21994372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 22543354 - 22543385
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22543354 |
ggctaaaatatggttttggtccctgcaaatat |
22543385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 22543718 - 22543687
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22543718 |
ggctaaaatatggttttggtccctgcaaatat |
22543687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 23502237 - 23502268
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23502237 |
ggctaaaatatggttttggtccctgcaaatat |
23502268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25137357 - 25137326
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25137357 |
ggctaaaatatggttttggtccctgcaaatat |
25137326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 31198615 - 31198646
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatat |
31198646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 195
Target Start/End: Complemental strand, 12757817 - 12757771
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccat |
195 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
12757817 |
cacttttgtgatgggttgcacatgtgacacatgatgactgaacccat |
12757771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 195
Target Start/End: Original strand, 14656023 - 14656069
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccat |
195 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
14656023 |
cacttttgtgacgatttgcacatgtgacacatgatcactgaacccat |
14656069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 15962400 - 15962358
Alignment:
| Q |
14 |
aataacttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
15962400 |
aataaattcttggctaaaatatggttttagtccctgcaaatat |
15962358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 58
Target Start/End: Complemental strand, 27765173 - 27765143
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27765173 |
taaaatatggttttggtccctgcaaatatat |
27765143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 494643 - 494590
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| || |||||| | ||||||||| |
|
|
| T |
494643 |
cacttttgtgatgatctgcatacgtggcacattataactgaatcaattttgtag |
494590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6591322 - 6591269
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
6591322 |
cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag |
6591269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7324074 - 7324021
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||| | ||||||| || |||||||| ||||||||| |
|
|
| T |
7324074 |
cacttttatgatgatttgcatacggggcacattataactgaaccaattttgtag |
7324021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 13617531 - 13617560
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatat |
13617560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 14655903 - 14655936
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatat |
14655936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 15076085 - 15076032
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
15076085 |
cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag |
15076032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 17771909 - 17771942
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
17771909 |
atggctaaaatatggttttagtccctgcaaatat |
17771942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 19267563 - 19267596
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
19267563 |
atggctaaaatatggttttggtccctgtaaatat |
19267596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 19320769 - 19320798
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatat |
19320798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 21165245 - 21165278
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
21165245 |
tggctaaaatatgcttttggtccctgcaaatata |
21165278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 30928926 - 30928873
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
30928926 |
cacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtag |
30928873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 494404 - 494436
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
494404 |
tggctaaaatatggttttagtccctgcaaatat |
494436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 2615872 - 2615904
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
2615872 |
ggctaaaatatggttttagtccctgcaaatata |
2615904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 3276367 - 3276399
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
3276367 |
ggctaaaatatgtttttggtccctgcaaatata |
3276399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 8170029 - 8169985
Alignment:
| Q |
153 |
tttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||||||||| ||||| |
|
|
| T |
8170029 |
tttgtgatgatttgcacacgtgacacatgatgactgaactcattt |
8169985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 12298825 - 12298853
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatat |
12298853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 13268461 - 13268429
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
13268461 |
tggctaaaataaggttttggtccctgcaaatat |
13268429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 16995451 - 16995483
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
16995451 |
ggctaaaatatgtttttggtccctgcaaatata |
16995483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 133 - 185
Target Start/End: Original strand, 17772016 - 17772068
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatga |
185 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
17772016 |
aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacaagatga |
17772068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 18810532 - 18810564
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
18810532 |
ggctaaaatatgattttggtccctgcaaatata |
18810564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 19296408 - 19296376
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
19296408 |
tggctaaaatatggttttagtccctgcaaatat |
19296376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 19690760 - 19690728
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
19690760 |
tggcgaaaatatggttttggtccctgcaaatat |
19690728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 21953206 - 21953238
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
21953206 |
ggctaaaatatgcttttggtccctgcaaatata |
21953238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Complemental strand, 25121377 - 25121337
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactga |
189 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
25121377 |
cacttttgtgatgatttgcacacgtgacacatgatgactga |
25121337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 30479179 - 30479227
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
30479179 |
cacttttgtgataatttgcgcacgtgacacatgatgactgaacccattt |
30479227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 31167201 - 31167169
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
31167201 |
tggctaaaatatggttttagtccctgcaaatat |
31167169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 34582892 - 34582860
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
34582892 |
ggctaaaatatggttttagtccctgcaaatata |
34582860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 137)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 43597379 - 43597294
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa |
238 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
43597379 |
ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag-tttttggtccctgcaaaatattttattttttaaaa |
43597294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 32691434 - 32691484
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
32691434 |
ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtag |
32691484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 24483501 - 24483570
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| |||||||| |||||||| ||||||||| |
|
|
| T |
24483501 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaattttgtag |
24483570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 1295427 - 1295379
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
1295427 |
cacttttgtgatgatttgcacatgtggcacatgatgactgaactcattt |
1295379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4424015 - 4424063
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
4424015 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4424063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 13215305 - 13215257
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13215305 |
cacttttatgatgatttgcacatgtggcacatgatgactgaacccattt |
13215257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16523109 - 16523157
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
16523109 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16523157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 23732209 - 23732161
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
23732209 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
23732161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 27109162 - 27109210
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
27109162 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
27109210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 37911000 - 37910952
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
37911000 |
cacttttgtgatgatttgcacatgtggcatatgatgactgaacccattt |
37910952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 40125086 - 40125134
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40125086 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40125134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 34317907 - 34317966
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
34317907 |
gtctctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
34317966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 43592167 - 43592217
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
43592167 |
ttttgtgatgatttgcatacgtggcacatgatgattgaacccgttttgtag |
43592217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 45442435 - 45442485
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
45442435 |
ttttgtgattatttgcatacgtggcacatgatgactgaaccgattttgtag |
45442485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 3838144 - 3838091
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
3838144 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
3838091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 7814503 - 7814434
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
7814503 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtag |
7814434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 7814636 - 7814567
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
7814636 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtag |
7814567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 8046432 - 8046501
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
8046432 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
8046501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 17541657 - 17541604
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
17541657 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
17541604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19183902 - 19183955
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
19183902 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
19183955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 23989955 - 23990008
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
23989955 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
23990008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 24483650 - 24483703
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
24483650 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
24483703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 26238914 - 26238979
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
26238914 |
aaatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaatttt |
26238979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 26814109 - 26814056
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
26814109 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
26814056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 35155412 - 35155465
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
35155412 |
cacttttgggatgatttgcacatgtgccacatgatgactgaactcattttgtag |
35155465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 37271983 - 37271930
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
37271983 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
37271930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 38980134 - 38980081
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
38980134 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
38980081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 43710482 - 43710551
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| ||||||||| || ||||||| ||||||||| |
|
|
| T |
43710482 |
aaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtag |
43710551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 1138102 - 1138150
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
1138102 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
1138150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4842951 - 4842999
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
4842951 |
cacttttgtgatgattttcacacgtggcacatgatgactgaacccattt |
4842999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10671750 - 10671798
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10671750 |
cacttttctgatgatttgcacacgtggcacatgatgactgaacccattt |
10671798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 20939205 - 20939157
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
20939205 |
cacttttgtgatgatttacacacgtggcacatgatgactgaacccattt |
20939157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25750846 - 25750798
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
25750846 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt |
25750798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 31909359 - 31909311
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
31909359 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
31909311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 35686221 - 35686173
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
35686221 |
cacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt |
35686173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 38231551 - 38231599
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
38231551 |
cacttttgtgataatttgcacatgtggcacatgatgactgaatccattt |
38231599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 43672052 - 43672100
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
43672052 |
cacttttgtgattatttgcacacgtggcacatgatgactgaacccattt |
43672100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 3832380 - 3832439
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | ||| ||||||||||||||||| |||| |
|
|
| T |
3832380 |
gtctctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
3832439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 5164387 - 5164328
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| | |||||||||||||||||||||| | ||| ||||||||||||||||| |||| |
|
|
| T |
5164387 |
gtctctggtctcacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
5164328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 34964052 - 34963993
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
34964052 |
gtctctggccccacttttgtaatgatttgcacacgtgacacatgatgactgaacccattt |
34963993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 31326129 - 31326080
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
31326129 |
ttttgtgatgatttgcatacgtggcacatgatgactg-gcccattttgtag |
31326080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 44993937 - 44993887
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| ||||| |||| |
|
|
| T |
44993937 |
ttttgtgatgatttgcatacgtggcacatgatgaccgaactcatttcgtag |
44993887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 146692 - 146659
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
146692 |
atggctaaaatatggttttggtccctgcaaatat |
146659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 4042771 - 4042722
Alignment:
| Q |
148 |
tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||||||| |||| |
|
|
| T |
4042771 |
tcacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
4042722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 5335042 - 5335009
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5335042 |
atggctaaaatatggttttggtccctgcaaatat |
5335009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 5790779 - 5790730
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
5790779 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
5790730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 10671630 - 10671663
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10671630 |
ggctaaaatatggttttggtccctgcaaatatat |
10671663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14393011 - 14392958
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||||| ||||||||| |
|
|
| T |
14393011 |
cacttttgtgatgatttgtatatgtggcacattataactgaactaattttgtag |
14392958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 16900014 - 16900067
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||||| ||||||||| |
|
|
| T |
16900014 |
cacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtag |
16900067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 16993405 - 16993458
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||||| ||||||||| |
|
|
| T |
16993405 |
cacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtag |
16993458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 20131683 - 20131650
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20131683 |
atggctaaaatatggttttggtccctgcaaatat |
20131650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 20658178 - 20658231
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
20658178 |
cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag |
20658231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 30215871 - 30215838
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30215871 |
ggctaaaatatggttttggtccctgcaaatatat |
30215838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 38731946 - 38731999
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || |||||||| ||||||||| |
|
|
| T |
38731946 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag |
38731999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 40302095 - 40302148
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||| |||| ||||||||| |
|
|
| T |
40302095 |
cacttttgtgatgatttgcatacgtggcacattataactcaaccaattttgtag |
40302148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 43789072 - 43789019
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||| || || |||||||| ||||||||| |
|
|
| T |
43789072 |
cacttttgtgatgatttgcatacgtggcatattatcactgaaccaattttgtag |
43789019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4794250 - 4794298
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| ||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
4794250 |
cacttttatgatgatttacacacgtggcacatgatgactgaacccattt |
4794298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 5334750 - 5334782
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5334750 |
tggctaaaatatggttttggtccctgcaaatat |
5334782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13850640 - 13850688
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||| ||||||||||| |
|
|
| T |
13850640 |
cacttttgtgatgatttgcacacgtgacacatgatgattgaacccattt |
13850688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 202
Target Start/End: Original strand, 33732979 - 33733031
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
33732979 |
acttttatgatgatttgcatacgtggcacattataactgaaccaattttgtag |
33733031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 34964160 - 34964128
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34964160 |
tggctaaaatatggttttggtccctgcaaatat |
34964128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 40124965 - 40124997
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40124965 |
tggctaaaatatggttttggtccctgcaaatat |
40124997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 42695867 - 42695899
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42695867 |
tggctaaaatatggttttggtccctgcaaatat |
42695899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 44559289 - 44559241
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
44559289 |
cacttttctgatgatttgcacacgtgacacatgatgactgaacccattt |
44559241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 2481313 - 2481356
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
2481313 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
2481356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 2481557 - 2481526
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2481557 |
ggctaaaatatggttttggtccctgcaaatat |
2481526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 4423895 - 4423926
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4423895 |
ggctaaaatatggttttggtccctgcaaatat |
4423926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 4424185 - 4424154
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4424185 |
ggctaaaatatggttttggtccctgcaaatat |
4424154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13215060 - 13215091
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13215060 |
ggctaaaatatggttttggtccctgcaaatat |
13215091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14003409 - 14003440
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14003409 |
ggctaaaatatggttttggtccctgcaaatat |
14003440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 14003742 - 14003711
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14003742 |
ggctaaaatatggttttggtccctgcaaatat |
14003711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 15842823 - 15842792
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15842823 |
ggctaaaatatggttttggtccctgcaaatat |
15842792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 16522991 - 16523022
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16522991 |
ggctaaaatatggttttggtccctgcaaatat |
16523022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 16523325 - 16523294
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16523325 |
ggctaaaatatggttttggtccctgcaaatat |
16523294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 16673411 - 16673442
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16673411 |
ggctaaaatatggttttggtccctgcaaatat |
16673442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 16673771 - 16673740
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16673771 |
ggctaaaatatggttttggtccctgcaaatat |
16673740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 18113089 - 18113120
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18113089 |
ggctaaaatatggttttggtccctgcaaatat |
18113120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20131317 - 20131348
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20131317 |
ggctaaaatatggttttggtccctgcaaatat |
20131348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 24358616 - 24358647
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24358616 |
ggctaaaatatggttttggtccctgcaaatat |
24358647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25705085 - 25705116
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25705085 |
ggctaaaatatggttttggtccctgcaaatat |
25705116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25705449 - 25705418
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25705449 |
ggctaaaatatggttttggtccctgcaaatat |
25705418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29859872 - 29859841
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29859872 |
ggctaaaatatggttttggtccctgcaaatat |
29859841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 30215422 - 30215453
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30215422 |
ggctaaaatatggttttggtccctgcaaatat |
30215453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 31644841 - 31644872
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31644841 |
ggctaaaatatggttttggtccctgcaaatat |
31644872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 31909478 - 31909447
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31909478 |
ggctaaaatatggttttggtccctgcaaatat |
31909447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 33576117 - 33576086
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33576117 |
ggctaaaatatggttttggtccctgcaaatat |
33576086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 36815713 - 36815666
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||||| | ||| ||||||||||||||| |||||| |
|
|
| T |
36815713 |
acttttgtgatgatttgcacacgtgacacatgatgactgaatccattt |
36815666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 37228733 - 37228764
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37228733 |
ggctaaaatatggttttggtccctgcaaatat |
37228764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 37911120 - 37911089
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37911120 |
ggctaaaatatggttttggtccctgcaaatat |
37911089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 41451837 - 41451868
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41451837 |
ggctaaaatatggttttggtccctgcaaatat |
41451868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 41451957 - 41452000
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
41451957 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacc |
41452000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 44559062 - 44559093
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44559062 |
ggctaaaatatggttttggtccctgcaaatat |
44559093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 1137970 - 1138012
Alignment:
| Q |
14 |
aataacttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
1137970 |
aataaattcaagactaaaatatggttttggtccctgcaaatat |
1138012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 192
Target Start/End: Original strand, 1696238 - 1696284
Alignment:
| Q |
146 |
cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacc |
192 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
1696238 |
cctcacttttgtgatgatttaaacacgtggcacatgatgactgaacc |
1696284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 197
Target Start/End: Original strand, 7121069 - 7121119
Alignment:
| Q |
147 |
ctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||| | ||||||||| |
|
|
| T |
7121069 |
ctcacttttgtgatgatttgcacacgtgacacatgatgattaaacccattt |
7121119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 20939324 - 20939294
Alignment:
| Q |
26 |
gctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatat |
20939294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 58
Target Start/End: Complemental strand, 37229039 - 37229009
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatat |
37229009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 58
Target Start/End: Original strand, 38979888 - 38979922
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
38979888 |
tggctaaaatatggttttagtccctgcaaatatat |
38979922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 146328 - 146357
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatat |
146357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 1497825 - 1497776
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| || |||||||| ||||| |
|
|
| T |
1497825 |
cacttttgtgatgatttgcatacgtggtacattataactgaaccaatttt |
1497776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 3172141 - 3172186
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||| |||||||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
3172141 |
ttttatgatgatttgcacatgtggcgcatgatgactgaactcattt |
3172186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 3172289 - 3172334
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||| |||||||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
3172289 |
ttttatgatgatttgcacatgtggcgcatgatgactgaactcattt |
3172334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 9195052 - 9195085
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
9195052 |
atggctaaaatatggttttagtccctgcaaatat |
9195085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 10375071 - 10375038
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
10375071 |
atggctaaaatatggttttagtccctgcaaatat |
10375038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 10665086 - 10665155
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || ||||||||||||||||| |||| |||| |||| || |||||| | ||||||||| |
|
|
| T |
10665086 |
aaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaagcaattttgtag |
10665155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 13802618 - 13802659
Alignment:
| Q |
157 |
tgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
13802618 |
tgatgatttgcatatgtggtacatgataactgaatccatttt |
13802659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 22881851 - 22881798
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| |||| ||||||||| |
|
|
| T |
22881851 |
cacttttgtgatgatttgcatacgtgtcacattataactaaaccaattttgtag |
22881798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 25300038 - 25300009
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatat |
25300009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 25954307 - 25954254
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| || ||||| || |||||||| ||||||||| |
|
|
| T |
25954307 |
cacttttgtgatgatttgcatacgtaacacattataactgaaccaattttgtag |
25954254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 26707990 - 26708043
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||||||| ||||||||| |
|
|
| T |
26707990 |
cacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtag |
26708043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 36806898 - 36806865
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
36806898 |
atggccaaaatatggttttggtccctgcaaatat |
36806865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 40786579 - 40786632
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || | |||||| ||||||||| |
|
|
| T |
40786579 |
cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag |
40786632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 44559407 - 44559378
Alignment:
| Q |
27 |
ctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatat |
44559378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 44985740 - 44985793
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| | || |||||||| ||||||||| |
|
|
| T |
44985740 |
cacttttgtgatgatttgcatacgtgacacgttataactgaaccaattttgtag |
44985793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 1777469 - 1777501
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
1777469 |
ggctaaaatatgtttttggtccctgcaaatata |
1777501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 2412487 - 2412455
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
2412487 |
ggctaaaatatgtttttggtccctgcaaatata |
2412455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 3832634 - 3832606
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatat |
3832606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 4042891 - 4042859
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
4042891 |
tggctaaaatatggtttaggtccctgcaaatat |
4042859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 5790900 - 5790868
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
5790900 |
tggctaaaatatggttttagtccctgcaaatat |
5790868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 11713484 - 11713516
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
11713484 |
tggctaaaatatggttttagtccctgcaaatat |
11713516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 191
Target Start/End: Original strand, 11788174 - 11788214
Alignment:
| Q |
151 |
cttttgtgatgatttgcatatgtggcacatgatgactgaac |
191 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
11788174 |
cttttgtgatgatttgcacatgtgacacatgataactgaac |
11788214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 198
Target Start/End: Original strand, 12835446 - 12835494
Alignment:
| Q |
150 |
acttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || || ||||| ||||| |
|
|
| T |
12835446 |
acttttgtgatgatttgcatacgtggcacattataacggaaccaatttt |
12835494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 15842464 - 15842492
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatat |
15842492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 18113209 - 18113257
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||||||||||||| || | || ||||||||||| ||||||||||| |
|
|
| T |
18113209 |
cacttttgtgatgatttacacacgtagcacatgatgagtgaacccattt |
18113257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 18113455 - 18113423
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
18113455 |
tggctaaaatatggttttggtccctacaaatat |
18113423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 25977870 - 25977902
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
25977870 |
ggctaaaatatgtttttggtccctgcaaatata |
25977902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 25979310 - 25979278
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
25979310 |
ggctaaaatatgtttttggtccctgcaaatata |
25979278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26813865 - 26813897
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
26813865 |
tggctaaaatatggttttagtccctgcaaatat |
26813897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 27109072 - 27109104
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
27109072 |
tggctaaaatatggttttggtccctacaaatat |
27109104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 29182288 - 29182336
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||| |||| ||||| |
|
|
| T |
29182288 |
cacttttgtgatgatttgcacacgtgacacatgatgaccgaactcattt |
29182336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 29859490 - 29859518
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatat |
29859518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 32476090 - 32476126
Alignment:
| Q |
20 |
ttcatggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
32476090 |
ttcaaggctaaaatatggttttgatccctgcaaatat |
32476126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 33733242 - 33733210
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
33733242 |
tggctaaaatatggttttagtccctgcaaatat |
33733210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 34317797 - 34317829
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34317797 |
tggctaaaatatgattttggtccctgcaaatat |
34317829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 34318084 - 34318052
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
34318084 |
tggctaaaatatggttttggtccctacaaatat |
34318052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 41791313 - 41791281
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
41791313 |
tggctaaaatatggttttagtccctgcaaatat |
41791281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 42695988 - 42696036
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||| |||||||||||||| |
|
|
| T |
42695988 |
cacttttgtgatgatttgcacacgtgacacatgtagactgaacccattt |
42696036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16843 - 16891
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16843 |
cacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt |
16891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 58
Target Start/End: Original strand, 16723 - 16757
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatatat |
58 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16723 |
tggctaaaatatgattttggtccctgcaaatatat |
16757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 14799 - 14868
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
14799 |
aaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
14868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 2415 - 2463
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2415 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 2660 - 2629
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2660 |
ggctaaaatatggttttggtccctgcaaatat |
2629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 34965 - 34917
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34965 |
cacttttatgatgatttgcatatgtgacacatgatgactgaacccattt |
34917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 148006 - 148054
Alignment:
| Q |
148 |
tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatt |
196 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
148006 |
tcacttttgtgatgatttgcacacgtggcacatgatgactgaacccatt |
148054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 148282 - 148251
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatat |
148251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 119592 - 119625
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
119592 |
tggctaaaatatgcttttggtccctgcaaatata |
119625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 121044 - 121012
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
121044 |
ggctaaaatatgcttttggtccctgcaaatata |
121012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 366154 - 366104
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
366154 |
ttttgtgatgatttgtatacgtggcacatgatgactgaacctattttgtag |
366104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5329 - 5382
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
5329 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5349 - 5402
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
5349 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 8667 - 8720
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
8667 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
8720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 170 - 117
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
170 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 242
Target Start/End: Complemental strand, 17839 - 17752
Alignment:
| Q |
154 |
ttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt |
242 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||| |||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
17839 |
ttgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag-aaaaaagtccttgcaaaatatattgttttttaaaatagt |
17752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 17967 - 17935
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
17967 |
tggctaaaatatggttttagtccctgcaaatat |
17935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 56
Target Start/End: Complemental strand, 2886 - 2852
Alignment:
| Q |
22 |
catggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2886 |
catggctaaaatatggttttggtccctgcaaatat |
2852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 2622 - 2670
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
2622 |
cacttttgtgattatttgcacacgtggcacatgatgactgaactcattt |
2670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 8905 - 8856
Alignment:
| Q |
153 |
tttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
8905 |
tttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
8856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 138 - 191
Target Start/End: Original strand, 7054 - 7107
Alignment:
| Q |
138 |
gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaac |
191 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
7054 |
gtctctggccccacttttgtgatgatttgcacatgtgacacatgatgacggaac |
7107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 4194 - 4141
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
4194 |
cacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtag |
4141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 4313 - 4281
Alignment:
| Q |
24 |
tggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
4313 |
tggctaaaatatggttttagtccctgcaaatat |
4281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 17245 - 17294
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |||| |||||| |
|
|
| T |
17245 |
cacttttgtgatgatttgcaaatgtgacacatgatgaccgaactcatttt |
17294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 3189 - 3120
Alignment:
| Q |
133 |
aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |||| |||| || |||||| | ||||||||| |
|
|
| T |
3189 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaatcaattttgtag |
3120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 35152 - 35103
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||||||| ||||| |
|
|
| T |
35152 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
35103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 5583 - 5534
Alignment:
| Q |
153 |
tttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
5583 |
tttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 12302 - 12355
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
12302 |
cacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtag |
12355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 30966 - 30934
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30966 |
ggctaaaatatggttttggtccctgcaaatata |
30934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 82461 - 82509
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |||| |||| |
|
|
| T |
82461 |
cacttttgtgatgatttgcacacgtggcacatgatgactaaaccaattt |
82509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 82706 - 82675
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
82706 |
ggctaaaatatggttttggtccctgcaaatat |
82675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 55
Target Start/End: Original strand, 82341 - 82371
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaata |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
82341 |
ggctaaaatatggttttggtccctgcaaata |
82371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 189448 - 189496
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||| ||||||||||| |
|
|
| T |
189448 |
cacttttgtgatgatttgcacacgtggcatatgatgattgaacccattt |
189496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 27364 - 27333
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27364 |
ggctaaaatatggttttggtccctgcaaatat |
27333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3752 - 3783
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3752 |
ggctaaaatatggttttggtccctgcaaatat |
3783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 3871 - 3918
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||||||| ||||| |
|
|
| T |
3871 |
cacttttgtgatgatt-gcacacgtggcacatgatgactgaactcattt |
3918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 147 - 202
Target Start/End: Complemental strand, 3803 - 3748
Alignment:
| Q |
147 |
ctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||||| ||| ||||||||| |
|
|
| T |
3803 |
ctcatttttgttatgatttgcatacgtggcacatgatgactaaactgattttgtag |
3748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 3530 - 3563
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
3530 |
atggctaaaatatggttttagtccctgcaaatat |
3563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 75764 - 75733
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
75764 |
ggctaaaatatggttttggtccctgcaaatat |
75733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47925 - 47956
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47925 |
ggctaaaatatggttttggtccctgcaaatat |
47956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 223172 - 223141
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
223172 |
ggctaaaatatggttttggtccctgcaaatat |
223141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 48228 - 48200
Alignment:
| Q |
28 |
taaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatat |
48200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 2898 - 2948
Alignment:
| Q |
152 |
ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||| ||||| ||||||| |
|
|
| T |
2898 |
ttttgtgatgatttgtatacgtggcacaagatgactggacccaatttgtag |
2948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Original strand, 10313 - 10347
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
10313 |
atggctaaaatatgcttttggtccctgcaaatata |
10347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 11581 - 11549
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
11581 |
ggctaaaatatgtttttggtccctgcaaatata |
11549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 12523 - 12556
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
12523 |
atggctaaaatatggttttagtccctgcaaatat |
12556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 17924 - 17871
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| | || |||||||| ||||||||| |
|
|
| T |
17924 |
cacttttgtgatgatttgcatacgtgtcactttataactgaaccaattttgtag |
17871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 50080 - 50047
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
50080 |
atggttaaaatatggttttggtccctgcaaatat |
50047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 55181 - 55148
Alignment:
| Q |
23 |
atggctaaaatatggttttggtccctgcaaatat |
56 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
55181 |
atggttaaaatatggttttggtccctgcaaatat |
55148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 10275 - 10328
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || | |||||| ||||||||| |
|
|
| T |
10275 |
cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag |
10328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 490 - 458
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
490 |
ggctaaaatatgattttggtccctgcaaatata |
458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 21810 - 21858
Alignment:
| Q |
149 |
cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt |
197 |
Q |
| |
|
|||||||||||||||||||| | ||||||| |||||| |||||| |||| |
|
|
| T |
21810 |
cacttttgtgatgatttgcacacgtggcacgtgatgattgaaccaattt |
21858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 202579 - 202611
Alignment:
| Q |
25 |
ggctaaaatatggttttggtccctgcaaatata |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
202579 |
ggctaaaatatgcttttggtccctgcaaatata |
202611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University