View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1453_high_20 (Length: 271)

Name: NF1453_high_20
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1453_high_20
NF1453_high_20
[»] chr8 (151 HSPs)
chr8 (146-238)||(14496929-14497020)
chr8 (152-202)||(14488837-14488887)
chr8 (152-202)||(7578359-7578409)
chr8 (152-202)||(29487939-29487989)
chr8 (152-238)||(33526175-33526260)
chr8 (152-202)||(10755359-10755409)
chr8 (152-202)||(14238872-14238922)
chr8 (152-202)||(15719778-15719828)
chr8 (152-202)||(43727258-43727308)
chr8 (133-202)||(18549307-18549376)
chr8 (133-202)||(32418507-32418576)
chr8 (149-197)||(7326206-7326254)
chr8 (149-197)||(7420350-7420398)
chr8 (149-197)||(8298707-8298755)
chr8 (149-197)||(28497374-28497422)
chr8 (149-197)||(35115531-35115579)
chr8 (152-198)||(10873112-10873158)
chr8 (148-202)||(23360490-23360544)
chr8 (152-202)||(30337044-30337094)
chr8 (133-202)||(1163015-1163084)
chr8 (149-202)||(1525929-1525982)
chr8 (149-198)||(2811561-2811610)
chr8 (149-202)||(4017022-4017075)
chr8 (149-202)||(4375809-4375862)
chr8 (149-202)||(6146776-6146829)
chr8 (149-202)||(10776326-10776379)
chr8 (149-202)||(19494238-19494291)
chr8 (133-202)||(21125849-21125918)
chr8 (133-202)||(24187670-24187739)
chr8 (149-202)||(38930421-38930474)
chr8 (152-238)||(40844329-40844414)
chr8 (152-197)||(42429952-42429997)
chr8 (152-238)||(43477306-43477391)
chr8 (149-197)||(1778684-1778732)
chr8 (149-197)||(4473824-4473872)
chr8 (149-197)||(9175204-9175252)
chr8 (149-197)||(13232318-13232366)
chr8 (149-197)||(14847945-14847993)
chr8 (149-197)||(15931101-15931149)
chr8 (149-197)||(23939667-23939715)
chr8 (149-197)||(44998097-44998145)
chr8 (146-197)||(2356002-2356053)
chr8 (133-202)||(7272524-7272593)
chr8 (23-56)||(7326390-7326423)
chr8 (23-56)||(8298585-8298618)
chr8 (23-56)||(13232531-13232564)
chr8 (149-202)||(14495228-14495281)
chr8 (149-202)||(21509814-21509867)
chr8 (133-202)||(22650570-22650639)
chr8 (152-197)||(27117868-27117913)
chr8 (149-202)||(28398867-28398920)
chr8 (23-56)||(30969686-30969719)
chr8 (133-202)||(32040201-32040270)
chr8 (133-202)||(32195383-32195452)
chr8 (149-202)||(33636442-33636495)
chr8 (23-56)||(35346627-35346660)
chr8 (146-191)||(36044629-36044674)
chr8 (24-56)||(1778563-1778595)
chr8 (24-56)||(2728566-2728598)
chr8 (149-197)||(4621186-4621234)
chr8 (24-56)||(7185973-7186005)
chr8 (149-197)||(10540569-10540616)
chr8 (149-197)||(13779367-13779415)
chr8 (24-56)||(14489042-14489074)
chr8 (149-197)||(24090239-24090287)
chr8 (149-197)||(29992133-29992181)
chr8 (146-186)||(33652398-33652438)
chr8 (24-56)||(34963633-34963665)
chr8 (24-56)||(35097661-35097693)
chr8 (24-56)||(37536388-37536420)
chr8 (24-56)||(42132863-42132895)
chr8 (149-197)||(42132984-42133032)
chr8 (24-56)||(42133123-42133155)
chr8 (25-56)||(3512235-3512266)
chr8 (25-56)||(4710189-4710220)
chr8 (149-192)||(6146634-6146677)
chr8 (25-56)||(7420230-7420261)
chr8 (25-56)||(8298944-8298975)
chr8 (25-56)||(9496341-9496372)
chr8 (25-56)||(9496692-9496723)
chr8 (25-56)||(10337119-10337150)
chr8 (25-56)||(10337418-10337449)
chr8 (25-56)||(10540751-10540782)
chr8 (25-56)||(11019520-11019551)
chr8 (25-56)||(11019826-11019857)
chr8 (25-56)||(11976373-11976404)
chr8 (149-192)||(11976573-11976616)
chr8 (25-56)||(17073807-17073838)
chr8 (25-56)||(17574432-17574463)
chr8 (25-56)||(20277692-20277723)
chr8 (25-56)||(20984146-20984177)
chr8 (25-56)||(21064319-21064350)
chr8 (25-56)||(25600230-25600261)
chr8 (25-56)||(25702778-25702809)
chr8 (25-56)||(27117945-27117976)
chr8 (150-197)||(28324014-28324061)
chr8 (25-56)||(28346394-28346425)
chr8 (25-56)||(28346727-28346758)
chr8 (25-56)||(32725907-32725938)
chr8 (25-56)||(32726240-32726271)
chr8 (25-56)||(34963300-34963331)
chr8 (25-56)||(35097328-35097359)
chr8 (25-56)||(35346967-35346998)
chr8 (25-56)||(37536086-37536117)
chr8 (149-192)||(40493072-40493115)
chr8 (25-56)||(42430089-42430120)
chr8 (25-55)||(4473704-4473734)
chr8 (24-58)||(15719655-15719689)
chr8 (152-198)||(16643875-16643921)
chr8 (152-202)||(19963119-19963169)
chr8 (26-56)||(24090457-24090487)
chr8 (152-198)||(35143678-35143724)
chr8 (23-56)||(1162907-1162940)
chr8 (149-198)||(1408186-1408235)
chr8 (23-56)||(4375690-4375723)
chr8 (23-56)||(4621323-4621356)
chr8 (152-197)||(9832390-9832435)
chr8 (149-202)||(16789201-16789254)
chr8 (23-56)||(16789338-16789371)
chr8 (149-198)||(22917759-22917808)
chr8 (149-202)||(25131228-25131281)
chr8 (149-190)||(25702708-25702749)
chr8 (24-57)||(28998020-28998053)
chr8 (23-56)||(33526050-33526083)
chr8 (133-198)||(40066597-40066662)
chr8 (25-57)||(1385582-1385614)
chr8 (25-57)||(1420469-1420501)
chr8 (149-189)||(1685234-1685274)
chr8 (20-56)||(7272415-7272451)
chr8 (25-57)||(10717121-10717153)
chr8 (25-57)||(10718475-10718507)
chr8 (24-56)||(10776468-10776500)
chr8 (24-56)||(10873249-10873281)
chr8 (28-56)||(11976705-11976733)
chr8 (149-197)||(13155006-13155054)
chr8 (28-56)||(13232201-13232229)
chr8 (149-197)||(17074000-17074048)
chr8 (28-56)||(17574105-17574133)
chr8 (149-197)||(17574222-17574270)
chr8 (149-197)||(20277812-20277860)
chr8 (149-197)||(21064439-21064487)
chr8 (24-56)||(23939546-23939578)
chr8 (149-197)||(24814825-24814873)
chr8 (149-197)||(25600351-25600399)
chr8 (24-56)||(28398755-28398787)
chr8 (24-56)||(32195279-32195311)
chr8 (26-54)||(36044763-36044791)
chr8 (25-57)||(36588222-36588254)
chr8 (25-57)||(38456757-38456789)
chr8 (24-56)||(40066789-40066821)
chr8 (24-56)||(40844155-40844187)
[»] chr3 (175 HSPs)
chr3 (132-202)||(45313690-45313760)
chr3 (133-238)||(4814694-4814798)
chr3 (152-202)||(43440614-43440664)
chr3 (152-202)||(3830253-3830303)
chr3 (152-202)||(4513449-4513499)
chr3 (152-202)||(15016575-15016625)
chr3 (152-202)||(30552266-30552316)
chr3 (152-202)||(46186598-46186648)
chr3 (152-202)||(51759942-51759992)
chr3 (152-202)||(53701481-53701531)
chr3 (133-202)||(3151939-3152008)
chr3 (133-202)||(8510318-8510387)
chr3 (136-197)||(35565615-35565676)
chr3 (149-194)||(36732758-36732803)
chr3 (149-202)||(39436936-39436989)
chr3 (149-198)||(51058709-51058758)
chr3 (149-197)||(1721207-1721255)
chr3 (149-197)||(2486734-2486782)
chr3 (149-197)||(4034837-4034885)
chr3 (149-197)||(9261986-9262034)
chr3 (149-197)||(9596927-9596975)
chr3 (150-202)||(10778560-10778612)
chr3 (149-197)||(20405055-20405103)
chr3 (149-197)||(20644625-20644673)
chr3 (149-197)||(35177375-35177423)
chr3 (149-197)||(40277942-40277990)
chr3 (146-197)||(47114646-47114697)
chr3 (152-202)||(15286332-15286382)
chr3 (14-56)||(45313832-45313874)
chr3 (152-202)||(50196420-50196470)
chr3 (152-202)||(51500514-51500564)
chr3 (149-202)||(4950195-4950248)
chr3 (133-202)||(7518275-7518344)
chr3 (149-202)||(13584123-13584176)
chr3 (149-202)||(19656731-19656784)
chr3 (149-202)||(21159644-21159697)
chr3 (149-202)||(22156049-22156102)
chr3 (133-202)||(28427436-28427505)
chr3 (133-202)||(30130260-30130329)
chr3 (149-202)||(37506986-37507039)
chr3 (152-197)||(40370420-40370465)
chr3 (149-197)||(7957059-7957107)
chr3 (149-197)||(11463313-11463361)
chr3 (133-201)||(16123244-16123312)
chr3 (149-197)||(30034304-30034352)
chr3 (149-197)||(35407559-35407607)
chr3 (149-197)||(35533397-35533445)
chr3 (149-197)||(45006006-45006054)
chr3 (146-202)||(53719154-53719210)
chr3 (149-200)||(14772332-14772383)
chr3 (146-197)||(16679796-16679847)
chr3 (149-196)||(28418661-28418708)
chr3 (138-197)||(29678219-29678278)
chr3 (146-197)||(38232440-38232491)
chr3 (152-202)||(18175909-18175959)
chr3 (152-198)||(30268605-30268651)
chr3 (149-202)||(275561-275614)
chr3 (23-56)||(4034715-4034748)
chr3 (149-202)||(10977097-10977150)
chr3 (133-198)||(12673837-12673902)
chr3 (149-202)||(14633715-14633768)
chr3 (23-56)||(15979336-15979369)
chr3 (149-202)||(20757518-20757571)
chr3 (149-202)||(20907285-20907338)
chr3 (23-56)||(26090047-26090080)
chr3 (23-56)||(27681324-27681357)
chr3 (149-202)||(34238717-34238770)
chr3 (149-202)||(39072041-39072094)
chr3 (149-202)||(39288727-39288780)
chr3 (149-202)||(45161231-45161284)
chr3 (149-202)||(49670666-49670719)
chr3 (149-190)||(52342421-52342462)
chr3 (149-197)||(3387385-3387433)
chr3 (24-56)||(4035022-4035054)
chr3 (149-197)||(5345522-5345570)
chr3 (149-197)||(9603749-9603797)
chr3 (149-197)||(19844386-19844434)
chr3 (25-57)||(20405191-20405223)
chr3 (24-56)||(22008859-22008891)
chr3 (149-197)||(25609963-25610011)
chr3 (24-56)||(26089729-26089761)
chr3 (149-197)||(29686658-29686706)
chr3 (25-57)||(30106188-30106220)
chr3 (149-193)||(31480336-31480380)
chr3 (25-57)||(39820631-39820663)
chr3 (24-56)||(43441269-43441301)
chr3 (149-197)||(47005274-47005322)
chr3 (25-57)||(47433836-47433868)
chr3 (24-56)||(49323781-49323813)
chr3 (148-192)||(49323983-49324027)
chr3 (149-197)||(52956532-52956580)
chr3 (149-197)||(53113503-53113551)
chr3 (25-56)||(474044-474075)
chr3 (25-56)||(474377-474408)
chr3 (25-56)||(1721421-1721452)
chr3 (149-192)||(8940362-8940405)
chr3 (25-56)||(9262124-9262155)
chr3 (25-56)||(9603888-9603919)
chr3 (25-56)||(12740907-12740938)
chr3 (149-192)||(12741027-12741070)
chr3 (25-56)||(12741240-12741271)
chr3 (25-56)||(14772211-14772242)
chr3 (25-56)||(19844550-19844581)
chr3 (25-56)||(21553889-21553920)
chr3 (149-192)||(22008727-22008770)
chr3 (149-192)||(22016245-22016288)
chr3 (25-56)||(25615975-25616006)
chr3 (25-56)||(28552021-28552052)
chr3 (25-56)||(28552352-28552383)
chr3 (25-56)||(29490712-29490743)
chr3 (25-56)||(31480136-31480167)
chr3 (25-56)||(39132875-39132906)
chr3 (25-56)||(40370558-40370589)
chr3 (25-56)||(40545564-40545595)
chr3 (25-56)||(45002021-45002052)
chr3 (149-192)||(45002141-45002184)
chr3 (25-56)||(47005154-47005185)
chr3 (25-56)||(47005488-47005519)
chr3 (25-56)||(47336228-47336259)
chr3 (25-56)||(47336550-47336581)
chr3 (149-192)||(47901919-47901962)
chr3 (25-56)||(51550082-51550113)
chr3 (25-56)||(51550415-51550446)
chr3 (25-56)||(52342195-52342226)
chr3 (25-56)||(53113443-53113474)
chr3 (25-56)||(54608518-54608549)
chr3 (25-56)||(54608832-54608863)
chr3 (149-196)||(54767291-54767338)
chr3 (26-56)||(25610099-25610129)
chr3 (26-56)||(28418869-28418899)
chr3 (149-199)||(29446074-29446124)
chr3 (152-202)||(30426113-30426163)
chr3 (149-187)||(36673083-36673121)
chr3 (26-56)||(36673214-36673244)
chr3 (152-202)||(46901222-46901272)
chr3 (27-56)||(2486871-2486900)
chr3 (23-56)||(10976976-10977009)
chr3 (149-202)||(20612727-20612780)
chr3 (133-202)||(25710700-25710769)
chr3 (149-198)||(26800008-26800057)
chr3 (149-202)||(29955418-29955471)
chr3 (149-202)||(30004572-30004625)
chr3 (211-252)||(32635673-32635714)
chr3 (149-202)||(40169481-40169534)
chr3 (23-56)||(40370283-40370316)
chr3 (149-202)||(45320808-45320861)
chr3 (215-248)||(46724626-46724659)
chr3 (24-57)||(52708644-52708677)
chr3 (28-56)||(863621-863649)
chr3 (24-56)||(7957195-7957227)
chr3 (24-56)||(8510213-8510245)
chr3 (28-56)||(8940494-8940522)
chr3 (24-56)||(9261788-9261820)
chr3 (24-56)||(15016387-15016419)
chr3 (24-56)||(19844264-19844296)
chr3 (24-56)||(20644504-20644536)
chr3 (25-57)||(20644844-20644876)
chr3 (24-56)||(25710839-25710871)
chr3 (24-56)||(29678356-29678388)
chr3 (25-53)||(30128284-30128312)
chr3 (24-56)||(31480469-31480501)
chr3 (25-57)||(35565508-35565540)
chr3 (28-56)||(35569105-35569133)
chr3 (25-57)||(35936780-35936812)
chr3 (149-197)||(39132739-39132787)
chr3 (24-56)||(40169623-40169655)
chr3 (25-57)||(40477401-40477433)
chr3 (149-201)||(40979479-40979531)
chr3 (25-57)||(44506582-44506614)
chr3 (25-57)||(44507826-44507858)
chr3 (24-56)||(44802281-44802313)
chr3 (25-57)||(46026076-46026108)
chr3 (25-57)||(46104343-46104375)
chr3 (25-57)||(53121302-53121334)
chr3 (25-57)||(54437494-54437526)
[»] scaffold0060 (1 HSPs)
scaffold0060 (152-201)||(8453-8502)
[»] chr4 (145 HSPs)
chr4 (133-202)||(22099739-22099808)
chr4 (133-238)||(29420330-29420434)
chr4 (152-198)||(45505724-45505770)
chr4 (152-202)||(45593347-45593397)
chr4 (152-202)||(51545798-51545848)
chr4 (133-202)||(32365197-32365266)
chr4 (133-202)||(34355067-34355136)
chr4 (149-202)||(36702119-36702172)
chr4 (149-197)||(5203125-5203173)
chr4 (149-197)||(5797652-5797700)
chr4 (149-197)||(5827775-5827823)
chr4 (149-197)||(11692881-11692929)
chr4 (149-197)||(13530499-13530547)
chr4 (149-197)||(24774259-24774307)
chr4 (149-197)||(25424144-25424192)
chr4 (149-197)||(54208657-54208705)
chr4 (152-202)||(52441882-52441932)
chr4 (149-202)||(4279162-4279215)
chr4 (149-202)||(6827701-6827754)
chr4 (149-202)||(16712521-16712574)
chr4 (133-202)||(18830948-18831017)
chr4 (149-202)||(25358396-25358449)
chr4 (149-202)||(34361973-34362026)
chr4 (149-202)||(35415419-35415472)
chr4 (149-202)||(50714393-50714446)
chr4 (149-197)||(2034686-2034734)
chr4 (149-197)||(4211621-4211669)
chr4 (149-197)||(7642485-7642533)
chr4 (146-194)||(12791809-12791857)
chr4 (149-197)||(19903381-19903429)
chr4 (149-197)||(35119383-35119431)
chr4 (149-197)||(36050406-36050454)
chr4 (150-194)||(41439909-41439953)
chr4 (149-197)||(43200090-43200138)
chr4 (149-197)||(46115611-46115659)
chr4 (149-197)||(46128745-46128793)
chr4 (149-197)||(47022937-47022985)
chr4 (150-202)||(50822126-50822178)
chr4 (154-242)||(8191177-8191264)
chr4 (138-197)||(13073869-13073928)
chr4 (138-197)||(42823923-42823982)
chr4 (149-244)||(46292452-46292547)
chr4 (149-192)||(47135898-47135941)
chr4 (152-202)||(2180401-2180451)
chr4 (149-191)||(6353476-6353518)
chr4 (152-202)||(41346046-41346096)
chr4 (149-199)||(41620086-41620136)
chr4 (149-191)||(51738309-51738351)
chr4 (149-202)||(5063123-5063176)
chr4 (149-202)||(13479389-13479442)
chr4 (152-197)||(14488019-14488064)
chr4 (133-202)||(27008235-27008304)
chr4 (23-56)||(31560664-31560697)
chr4 (23-56)||(42848360-42848393)
chr4 (23-56)||(46292390-46292423)
chr4 (149-202)||(51708855-51708908)
chr4 (149-202)||(52017697-52017750)
chr4 (149-202)||(55482298-55482351)
chr4 (150-202)||(123722-123774)
chr4 (24-56)||(5827654-5827686)
chr4 (24-56)||(13073758-13073790)
chr4 (25-57)||(13074093-13074125)
chr4 (24-56)||(19321828-19321860)
chr4 (24-56)||(23245230-23245262)
chr4 (24-56)||(26412553-26412585)
chr4 (149-197)||(29380728-29380776)
chr4 (149-197)||(31812043-31812091)
chr4 (24-56)||(35464351-35464383)
chr4 (150-202)||(41920912-41920964)
chr4 (24-56)||(42824060-42824092)
chr4 (24-56)||(46115413-46115445)
chr4 (24-56)||(46128547-46128579)
chr4 (149-197)||(51763034-51763082)
chr4 (24-56)||(53308037-53308069)
chr4 (25-56)||(4211561-4211592)
chr4 (25-56)||(5827942-5827973)
chr4 (26-57)||(6353606-6353637)
chr4 (25-56)||(11693090-11693121)
chr4 (25-56)||(12152154-12152185)
chr4 (25-56)||(12152462-12152493)
chr4 (25-56)||(13530682-13530713)
chr4 (25-56)||(13631228-13631259)
chr4 (25-56)||(13631568-13631599)
chr4 (25-56)||(13764613-13764644)
chr4 (25-56)||(14487802-14487833)
chr4 (25-56)||(14488156-14488187)
chr4 (25-56)||(14594206-14594237)
chr4 (25-56)||(14791775-14791806)
chr4 (25-56)||(24774045-24774076)
chr4 (25-56)||(25423924-25423955)
chr4 (25-56)||(25424281-25424312)
chr4 (25-56)||(29420506-29420537)
chr4 (25-56)||(29499182-29499213)
chr4 (25-56)||(30046761-30046792)
chr4 (25-56)||(30061102-30061133)
chr4 (25-56)||(35119292-35119323)
chr4 (25-56)||(35464018-35464049)
chr4 (26-57)||(37557163-37557194)
chr4 (25-56)||(43231088-43231119)
chr4 (25-56)||(43231358-43231389)
chr4 (25-56)||(53915683-53915714)
chr4 (25-56)||(53916016-53916047)
chr4 (25-56)||(54903444-54903475)
chr4 (23-57)||(19675647-19675681)
chr4 (152-198)||(43368586-43368632)
chr4 (26-56)||(47136140-47136170)
chr4 (28-58)||(50753925-50753955)
chr4 (149-199)||(53717004-53717054)
chr4 (133-202)||(11285606-11285675)
chr4 (149-202)||(18135943-18135996)
chr4 (27-56)||(19903624-19903653)
chr4 (23-56)||(22099541-22099574)
chr4 (24-57)||(22204054-22204087)
chr4 (149-202)||(24474790-24474843)
chr4 (149-202)||(27427962-27428015)
chr4 (149-198)||(28197111-28197160)
chr4 (152-197)||(28449059-28449104)
chr4 (15-56)||(34361793-34361834)
chr4 (149-202)||(38054664-38054717)
chr4 (24-57)||(42359373-42359406)
chr4 (149-202)||(49123151-49123204)
chr4 (23-56)||(50714534-50714567)
chr4 (23-56)||(53717143-53717176)
chr4 (211-244)||(54121647-54121680)
chr4 (149-198)||(55072509-55072558)
chr4 (28-56)||(5202929-5202957)
chr4 (24-56)||(8191360-8191392)
chr4 (24-56)||(8905203-8905235)
chr4 (149-197)||(9836943-9836991)
chr4 (149-197)||(12152325-12152373)
chr4 (149-201)||(13064276-13064328)
chr4 (28-56)||(14791502-14791530)
chr4 (28-56)||(20144423-20144451)
chr4 (24-56)||(26313987-26314019)
chr4 (149-197)||(26314110-26314158)
chr4 (28-56)||(29499515-29499543)
chr4 (28-56)||(30060772-30060800)
chr4 (24-56)||(35415602-35415634)
chr4 (20-56)||(36054119-36054155)
chr4 (25-53)||(41324769-41324797)
chr4 (25-57)||(42358032-42358064)
chr4 (24-56)||(50714239-50714271)
chr4 (25-57)||(51545629-51545661)
chr4 (149-197)||(52543561-52543609)
chr4 (28-56)||(54208794-54208822)
[»] chr1 (176 HSPs)
chr1 (152-238)||(11822125-11822210)
chr1 (138-202)||(18079508-18079572)
chr1 (152-202)||(22919804-22919854)
chr1 (152-202)||(26191480-26191530)
chr1 (133-202)||(16083155-16083224)
chr1 (153-202)||(33067559-33067608)
chr1 (152-238)||(34808316-34808401)
chr1 (133-202)||(48609423-48609492)
chr1 (152-202)||(1811099-1811149)
chr1 (152-202)||(13770611-13770661)
chr1 (152-202)||(18899963-18900013)
chr1 (152-202)||(20756141-20756191)
chr1 (136-198)||(22674310-22674372)
chr1 (152-202)||(39303824-39303874)
chr1 (152-202)||(46868349-46868399)
chr1 (133-202)||(24649453-24649522)
chr1 (133-202)||(48955893-48955962)
chr1 (149-197)||(10887353-10887401)
chr1 (149-197)||(16060715-16060763)
chr1 (149-197)||(24510062-24510110)
chr1 (149-197)||(24977899-24977947)
chr1 (149-197)||(33234667-33234715)
chr1 (147-202)||(27521691-27521748)
chr1 (152-202)||(33380009-33380059)
chr1 (152-202)||(37545780-37545830)
chr1 (149-239)||(48730408-48730498)
chr1 (133-202)||(2733287-2733356)
chr1 (149-202)||(12361130-12361183)
chr1 (133-202)||(18302211-18302280)
chr1 (149-202)||(18473391-18473444)
chr1 (149-202)||(21383221-21383274)
chr1 (149-202)||(26442728-26442781)
chr1 (149-202)||(32728877-32728930)
chr1 (149-202)||(41358491-41358544)
chr1 (149-202)||(41881213-41881266)
chr1 (133-202)||(45290560-45290629)
chr1 (152-238)||(45368645-45368729)
chr1 (152-197)||(46183812-46183857)
chr1 (149-193)||(5058845-5058889)
chr1 (149-197)||(12360723-12360771)
chr1 (149-197)||(15466252-15466300)
chr1 (150-238)||(16097615-16097703)
chr1 (149-197)||(17129916-17129964)
chr1 (149-197)||(25658135-25658182)
chr1 (149-197)||(33045476-33045524)
chr1 (150-238)||(37624807-37624895)
chr1 (149-197)||(39747593-39747641)
chr1 (149-197)||(44157874-44157922)
chr1 (138-197)||(7350569-7350627)
chr1 (138-197)||(41738905-41738964)
chr1 (159-202)||(52254310-52254353)
chr1 (149-199)||(990206-990256)
chr1 (152-198)||(3753332-3753378)
chr1 (152-238)||(29072620-29072705)
chr1 (152-202)||(35005507-35005557)
chr1 (149-199)||(44641266-44641316)
chr1 (149-202)||(1159668-1159721)
chr1 (149-202)||(3679743-3679796)
chr1 (149-202)||(7001724-7001777)
chr1 (149-202)||(10552141-10552194)
chr1 (149-202)||(13260105-13260158)
chr1 (149-202)||(17984524-17984577)
chr1 (149-202)||(19622775-19622828)
chr1 (149-202)||(21391206-21391259)
chr1 (23-56)||(24510277-24510310)
chr1 (149-202)||(26062076-26062129)
chr1 (152-197)||(28507238-28507283)
chr1 (23-56)||(35056528-35056561)
chr1 (149-202)||(35307938-35307991)
chr1 (149-197)||(4789428-4789476)
chr1 (149-197)||(8364808-8364856)
chr1 (24-56)||(10631163-10631195)
chr1 (24-56)||(12322939-12322971)
chr1 (24-56)||(16060854-16060886)
chr1 (149-197)||(18927897-18927945)
chr1 (149-197)||(19198781-19198829)
chr1 (24-56)||(24653801-24653833)
chr1 (24-56)||(24977777-24977809)
chr1 (24-56)||(31060786-31060818)
chr1 (149-197)||(32035627-32035675)
chr1 (24-56)||(38151181-38151213)
chr1 (24-56)||(40718109-40718141)
chr1 (24-56)||(40718443-40718475)
chr1 (24-56)||(41738795-41738827)
chr1 (24-56)||(45638579-45638611)
chr1 (149-197)||(49923659-49923707)
chr1 (149-197)||(51986408-51986456)
chr1 (25-56)||(3247198-3247229)
chr1 (25-56)||(7867326-7867357)
chr1 (25-56)||(8140434-8140465)
chr1 (25-56)||(10631497-10631528)
chr1 (25-56)||(10887233-10887264)
chr1 (25-56)||(10887567-10887598)
chr1 (25-56)||(12360603-12360634)
chr1 (25-56)||(12360937-12360968)
chr1 (149-200)||(15335124-15335175)
chr1 (25-56)||(15516582-15516613)
chr1 (25-56)||(15526331-15526362)
chr1 (149-192)||(16026775-16026818)
chr1 (25-56)||(16026907-16026938)
chr1 (148-195)||(18208802-18208849)
chr1 (25-56)||(19720712-19720743)
chr1 (25-56)||(24507812-24507843)
chr1 (25-56)||(24654136-24654167)
chr1 (149-192)||(29688270-29688313)
chr1 (25-56)||(30322929-30322960)
chr1 (25-56)||(32035757-32035788)
chr1 (25-56)||(33000305-33000336)
chr1 (149-192)||(33000506-33000549)
chr1 (25-56)||(33000638-33000669)
chr1 (25-56)||(33045659-33045690)
chr1 (25-56)||(33234546-33234577)
chr1 (25-56)||(36912853-36912884)
chr1 (149-192)||(38150968-38151011)
chr1 (25-56)||(38164264-38164295)
chr1 (25-56)||(39747804-39747835)
chr1 (25-56)||(42482979-42483010)
chr1 (149-192)||(42483168-42483211)
chr1 (25-56)||(42483240-42483271)
chr1 (25-56)||(45380272-45380303)
chr1 (25-56)||(45638863-45638894)
chr1 (25-56)||(47819232-47819263)
chr1 (25-56)||(47819565-47819596)
chr1 (155-202)||(49226361-49226408)
chr1 (23-57)||(11711280-11711314)
chr1 (26-56)||(15058419-15058449)
chr1 (23-57)||(23469996-23470030)
chr1 (23-57)||(37396867-37396901)
chr1 (23-53)||(39025353-39025383)
chr1 (26-56)||(44157696-44157726)
chr1 (149-198)||(4323948-4323997)
chr1 (27-56)||(4789310-4789339)
chr1 (149-202)||(14007606-14007659)
chr1 (23-56)||(15211827-15211860)
chr1 (27-56)||(17130052-17130081)
chr1 (149-190)||(19720913-19720954)
chr1 (23-56)||(26191703-26191736)
chr1 (25-58)||(31061118-31061151)
chr1 (149-198)||(31258459-31258508)
chr1 (149-202)||(32454118-32454171)
chr1 (149-202)||(32626721-32626774)
chr1 (23-56)||(33234881-33234914)
chr1 (149-202)||(34383065-34383118)
chr1 (149-242)||(39025169-39025262)
chr1 (27-56)||(46183686-46183715)
chr1 (28-56)||(3247531-3247559)
chr1 (24-56)||(7001866-7001898)
chr1 (154-198)||(7818934-7818978)
chr1 (25-57)||(9774915-9774947)
chr1 (24-56)||(12322603-12322635)
chr1 (149-197)||(12322725-12322773)
chr1 (25-57)||(17977586-17977618)
chr1 (25-57)||(20723715-20723747)
chr1 (24-56)||(20948754-20948786)
chr1 (24-56)||(22953525-22953557)
chr1 (24-56)||(24507478-24507510)
chr1 (24-56)||(24649349-24649381)
chr1 (24-56)||(25658013-25658045)
chr1 (24-56)||(26191358-26191390)
chr1 (25-57)||(27262908-27262940)
chr1 (25-57)||(27264243-27264275)
chr1 (24-56)||(29072831-29072863)
chr1 (149-189)||(34002695-34002735)
chr1 (20-56)||(35307710-35307746)
chr1 (24-56)||(35308080-35308112)
chr1 (25-57)||(35721101-35721133)
chr1 (25-57)||(35911915-35911947)
chr1 (25-57)||(37395633-37395665)
chr1 (24-56)||(38136950-38136982)
chr1 (28-56)||(38150851-38150879)
chr1 (28-56)||(38163934-38163962)
chr1 (28-56)||(39025112-39025140)
chr1 (24-56)||(45380605-45380637)
chr1 (25-57)||(45979523-45979555)
chr1 (24-56)||(48956035-48956067)
chr1 (24-56)||(52254448-52254480)
[»] scaffold0002 (3 HSPs)
scaffold0002 (152-202)||(94180-94230)
scaffold0002 (25-57)||(345924-345956)
scaffold0002 (25-57)||(376396-376428)
[»] chr7 (146 HSPs)
chr7 (152-202)||(19757872-19757922)
chr7 (133-202)||(24953979-24954048)
chr7 (145-202)||(38186589-38186646)
chr7 (149-197)||(41054008-41054056)
chr7 (146-238)||(45671328-45671419)
chr7 (152-202)||(10358125-10358175)
chr7 (152-202)||(13769893-13769943)
chr7 (152-202)||(19465740-19465790)
chr7 (152-239)||(20388396-20388482)
chr7 (152-202)||(32189223-32189273)
chr7 (152-202)||(41365044-41365094)
chr7 (152-202)||(46648535-46648585)
chr7 (149-202)||(19561267-19561320)
chr7 (133-202)||(21223510-21223579)
chr7 (133-202)||(45073470-45073539)
chr7 (133-202)||(46304210-46304279)
chr7 (133-202)||(48358905-48358974)
chr7 (149-197)||(5354950-5354998)
chr7 (149-197)||(9659475-9659523)
chr7 (149-197)||(11767037-11767085)
chr7 (133-201)||(14738702-14738770)
chr7 (149-197)||(30223581-30223629)
chr7 (149-197)||(39520518-39520566)
chr7 (149-197)||(48852564-48852612)
chr7 (150-197)||(35470112-35470159)
chr7 (152-202)||(31310507-31310557)
chr7 (133-202)||(488816-488885)
chr7 (149-202)||(1007057-1007110)
chr7 (136-197)||(3808011-3808072)
chr7 (133-202)||(5308515-5308584)
chr7 (149-202)||(6108525-6108578)
chr7 (149-202)||(7432071-7432124)
chr7 (149-202)||(12894230-12894283)
chr7 (133-202)||(18311683-18311752)
chr7 (145-242)||(19005725-19005822)
chr7 (149-202)||(19783934-19783987)
chr7 (149-202)||(21554581-21554634)
chr7 (133-202)||(23816863-23816932)
chr7 (149-202)||(28911697-28911750)
chr7 (149-202)||(35015047-35015100)
chr7 (149-202)||(39719473-39719526)
chr7 (133-202)||(44403080-44403149)
chr7 (149-202)||(45021615-45021668)
chr7 (152-197)||(45228707-45228752)
chr7 (149-242)||(46759760-46759853)
chr7 (149-197)||(6589081-6589129)
chr7 (149-197)||(16940882-16940930)
chr7 (149-197)||(27458519-27458567)
chr7 (149-197)||(35104138-35104186)
chr7 (149-197)||(35665995-35666043)
chr7 (149-197)||(35838044-35838092)
chr7 (149-197)||(38486625-38486673)
chr7 (149-197)||(39438861-39438909)
chr7 (149-197)||(44841475-44841523)
chr7 (138-197)||(1271431-1271490)
chr7 (14-56)||(27037582-27037624)
chr7 (152-202)||(30352683-30352733)
chr7 (152-202)||(31732279-31732329)
chr7 (152-202)||(43300730-43300780)
chr7 (149-202)||(18022485-18022538)
chr7 (25-58)||(29198303-29198336)
chr7 (149-198)||(34877893-34877942)
chr7 (133-202)||(44508822-44508891)
chr7 (149-197)||(2945677-2945725)
chr7 (149-197)||(3975671-3975719)
chr7 (24-56)||(6589020-6589052)
chr7 (149-197)||(6892014-6892062)
chr7 (24-56)||(16853558-16853590)
chr7 (149-197)||(22540125-22540173)
chr7 (149-197)||(31503615-31503663)
chr7 (25-57)||(44568326-44568358)
chr7 (25-56)||(1614559-1614590)
chr7 (25-56)||(1614873-1614904)
chr7 (25-56)||(3975549-3975580)
chr7 (25-56)||(3975807-3975838)
chr7 (25-56)||(5233808-5233839)
chr7 (25-56)||(8144295-8144326)
chr7 (25-56)||(8144627-8144658)
chr7 (25-56)||(9659658-9659689)
chr7 (25-56)||(11767244-11767275)
chr7 (25-56)||(14543710-14543741)
chr7 (150-197)||(14543799-14543846)
chr7 (25-56)||(23399612-23399643)
chr7 (25-56)||(23399945-23399976)
chr7 (25-56)||(23676421-23676452)
chr7 (25-56)||(25092160-25092191)
chr7 (25-56)||(25092517-25092548)
chr7 (25-56)||(25988385-25988416)
chr7 (25-56)||(25988718-25988749)
chr7 (25-56)||(26878040-26878071)
chr7 (25-56)||(27458399-27458430)
chr7 (25-56)||(28262713-28262744)
chr7 (25-56)||(29198631-29198662)
chr7 (149-200)||(30709443-30709494)
chr7 (21-56)||(35469876-35469911)
chr7 (25-56)||(35837924-35837955)
chr7 (25-56)||(35838306-35838337)
chr7 (25-56)||(41053842-41053873)
chr7 (25-56)||(41054205-41054236)
chr7 (25-56)||(45228887-45228918)
chr7 (25-56)||(46759658-46759689)
chr7 (25-56)||(46828944-46828975)
chr7 (25-56)||(48192457-48192488)
chr7 (25-56)||(48852444-48852475)
chr7 (25-55)||(39438999-39439029)
chr7 (149-198)||(1559538-1559587)
chr7 (23-56)||(1974007-1974040)
chr7 (27-56)||(6847088-6847117)
chr7 (24-57)||(6911215-6911248)
chr7 (29-58)||(6954862-6954891)
chr7 (23-56)||(19561152-19561185)
chr7 (149-202)||(35210340-35210393)
chr7 (149-202)||(37372733-37372786)
chr7 (149-198)||(37952884-37952933)
chr7 (149-198)||(44344623-44344672)
chr7 (23-56)||(45021492-45021525)
chr7 (23-56)||(46829281-46829314)
chr7 (24-56)||(1006834-1006866)
chr7 (25-57)||(5611534-5611566)
chr7 (28-56)||(6589243-6589271)
chr7 (149-197)||(6846952-6847000)
chr7 (25-53)||(6892232-6892260)
chr7 (24-56)||(7431950-7431982)
chr7 (28-56)||(11766920-11766948)
chr7 (25-57)||(12933419-12933451)
chr7 (24-56)||(13769773-13769805)
chr7 (28-56)||(16941021-16941049)
chr7 (147-202)||(20355533-20355589)
chr7 (25-57)||(21223716-21223748)
chr7 (28-56)||(23676135-23676163)
chr7 (25-57)||(24195607-24195639)
chr7 (25-57)||(24197130-24197162)
chr7 (149-197)||(24717288-24717336)
chr7 (24-56)||(25547459-25547491)
chr7 (25-53)||(27037874-27037902)
chr7 (149-197)||(28262910-28262958)
chr7 (149-197)||(28529101-28529149)
chr7 (24-56)||(31732100-31732132)
chr7 (25-57)||(32197936-32197968)
chr7 (24-56)||(36748197-36748229)
chr7 (149-197)||(37527254-37527302)
chr7 (28-56)||(38186369-38186397)
chr7 (24-56)||(44508719-44508751)
chr7 (28-56)||(44841683-44841711)
chr7 (28-56)||(48192260-48192288)
chr7 (24-56)||(48359044-48359076)
[»] chr5 (133 HSPs)
chr5 (152-202)||(3850455-3850505)
chr5 (152-238)||(13990728-13990813)
chr5 (155-202)||(3850652-3850699)
chr5 (152-202)||(10743883-10743933)
chr5 (152-202)||(14318229-14318279)
chr5 (152-202)||(34125427-34125477)
chr5 (149-202)||(7075789-7075842)
chr5 (215-256)||(15141051-15141092)
chr5 (149-238)||(17070655-17070744)
chr5 (133-202)||(35166993-35167062)
chr5 (149-197)||(5103842-5103890)
chr5 (146-202)||(21050690-21050746)
chr5 (149-197)||(32108927-32108975)
chr5 (138-197)||(28213482-28213541)
chr5 (152-202)||(28863662-28863712)
chr5 (149-202)||(5614357-5614410)
chr5 (149-202)||(6118322-6118375)
chr5 (149-202)||(15635495-15635548)
chr5 (149-202)||(16616481-16616534)
chr5 (149-202)||(18633788-18633841)
chr5 (136-197)||(26071397-26071458)
chr5 (149-202)||(30888280-30888333)
chr5 (149-202)||(31602267-31602320)
chr5 (149-202)||(35165987-35166040)
chr5 (149-202)||(36577839-36577892)
chr5 (149-197)||(2636789-2636837)
chr5 (149-197)||(4736374-4736422)
chr5 (149-197)||(9588444-9588492)
chr5 (149-197)||(28107919-28107967)
chr5 (149-197)||(32888800-32888848)
chr5 (149-197)||(35609393-35609441)
chr5 (149-197)||(40038615-40038663)
chr5 (146-197)||(5904205-5904256)
chr5 (146-197)||(29855724-29855775)
chr5 (152-202)||(9532312-9532362)
chr5 (133-191)||(18286531-18286589)
chr5 (23-56)||(45136-45169)
chr5 (152-197)||(1104980-1105025)
chr5 (149-198)||(2217689-2217738)
chr5 (149-202)||(5950292-5950345)
chr5 (23-56)||(6912495-6912528)
chr5 (133-202)||(16038567-16038636)
chr5 (149-202)||(22551144-22551197)
chr5 (149-202)||(27850204-27850257)
chr5 (149-202)||(28550945-28550998)
chr5 (149-202)||(29151636-29151689)
chr5 (149-202)||(29172643-29172696)
chr5 (149-202)||(29692920-29692973)
chr5 (133-198)||(31037499-31037564)
chr5 (133-202)||(37090569-37090638)
chr5 (133-198)||(38496523-38496588)
chr5 (133-202)||(38786261-38786329)
chr5 (149-202)||(38962921-38962974)
chr5 (149-202)||(42207360-42207413)
chr5 (149-197)||(10830649-10830697)
chr5 (146-198)||(15916403-15916454)
chr5 (149-197)||(20690851-20690899)
chr5 (24-56)||(35928427-35928459)
chr5 (149-197)||(36973473-36973521)
chr5 (25-56)||(1104858-1104889)
chr5 (25-56)||(1105117-1105148)
chr5 (25-56)||(1381247-1381278)
chr5 (25-56)||(1381580-1381611)
chr5 (24-55)||(2636668-2636699)
chr5 (25-56)||(4736511-4736542)
chr5 (25-56)||(5917126-5917157)
chr5 (25-56)||(5917429-5917460)
chr5 (25-56)||(9588358-9588389)
chr5 (25-56)||(17070535-17070566)
chr5 (25-56)||(18258162-18258193)
chr5 (25-56)||(18258496-18258527)
chr5 (25-56)||(19565467-19565498)
chr5 (25-56)||(19565800-19565831)
chr5 (25-56)||(19685017-19685048)
chr5 (149-192)||(19685136-19685179)
chr5 (25-56)||(19685349-19685380)
chr5 (25-56)||(20660948-20660979)
chr5 (25-56)||(20690733-20690764)
chr5 (25-56)||(20986058-20986089)
chr5 (25-56)||(24443380-24443411)
chr5 (149-192)||(24443500-24443543)
chr5 (25-56)||(24443713-24443744)
chr5 (25-56)||(28213373-28213404)
chr5 (25-56)||(30888160-30888191)
chr5 (25-56)||(32108808-32108839)
chr5 (25-56)||(35876688-35876719)
chr5 (25-56)||(35877021-35877052)
chr5 (25-56)||(35928064-35928095)
chr5 (149-192)||(37271543-37271586)
chr5 (25-56)||(37271675-37271706)
chr5 (25-56)||(38170514-38170545)
chr5 (25-56)||(40764415-40764446)
chr5 (22-56)||(45473-45507)
chr5 (26-56)||(2636962-2636992)
chr5 (152-202)||(27916584-27916634)
chr5 (152-198)||(29875522-29875568)
chr5 (152-197)||(45335-45380)
chr5 (149-198)||(294024-294073)
chr5 (23-56)||(5103970-5104003)
chr5 (27-56)||(6912826-6912855)
chr5 (149-202)||(10409050-10409103)
chr5 (27-56)||(12145152-12145181)
chr5 (133-198)||(18046183-18046248)
chr5 (23-56)||(21050882-21050915)
chr5 (149-202)||(23382137-23382190)
chr5 (23-56)||(25561703-25561736)
chr5 (23-56)||(35609301-35609334)
chr5 (27-56)||(35609606-35609635)
chr5 (27-56)||(38452365-38452394)
chr5 (149-202)||(39379348-39379401)
chr5 (23-56)||(40029466-40029499)
chr5 (23-56)||(42553640-42553673)
chr5 (149-197)||(1286879-1286927)
chr5 (162-202)||(2032735-2032775)
chr5 (25-57)||(3936578-3936610)
chr5 (24-56)||(6118468-6118500)
chr5 (24-56)||(15916285-15916317)
chr5 (24-56)||(18633930-18633962)
chr5 (149-197)||(20661068-20661116)
chr5 (24-56)||(20661280-20661312)
chr5 (28-56)||(20985728-20985756)
chr5 (27-59)||(25254156-25254188)
chr5 (27-59)||(25317946-25317978)
chr5 (25-57)||(27571156-27571188)
chr5 (24-56)||(28550826-28550858)
chr5 (24-56)||(28863807-28863839)
chr5 (24-56)||(29366918-29366950)
chr5 (25-57)||(31540496-31540528)
chr5 (24-56)||(33335995-33336027)
chr5 (25-57)||(34911855-34911887)
chr5 (24-56)||(40038827-40038859)
chr5 (28-56)||(42596786-42596814)
chr5 (24-56)||(42994067-42994099)
[»] scaffold0811 (1 HSPs)
scaffold0811 (133-202)||(1471-1540)
[»] chr6 (110 HSPs)
chr6 (133-202)||(12612186-12612255)
chr6 (152-240)||(19275832-19275919)
chr6 (146-197)||(23502294-23502345)
chr6 (152-202)||(2373321-2373371)
chr6 (133-199)||(14428752-14428818)
chr6 (152-202)||(21995187-21995237)
chr6 (152-202)||(23770350-23770400)
chr6 (149-197)||(3414584-3414632)
chr6 (149-197)||(19320887-19320935)
chr6 (149-197)||(31198735-31198783)
chr6 (152-202)||(6468500-6468550)
chr6 (152-202)||(9896467-9896517)
chr6 (152-202)||(33131646-33131696)
chr6 (149-202)||(777867-777920)
chr6 (149-202)||(7155916-7155969)
chr6 (149-202)||(14655598-14655651)
chr6 (149-202)||(19296234-19296287)
chr6 (149-202)||(24273957-24274010)
chr6 (133-202)||(24692809-24692878)
chr6 (133-202)||(32885776-32885845)
chr6 (149-202)||(33801571-33801624)
chr6 (149-202)||(34582649-34582702)
chr6 (149-197)||(12298938-12298986)
chr6 (149-197)||(13617649-13617697)
chr6 (149-197)||(23628994-23629042)
chr6 (133-201)||(26375795-26375863)
chr6 (149-197)||(31185754-31185802)
chr6 (150-197)||(1214815-1214862)
chr6 (150-197)||(19690516-19690563)
chr6 (23-57)||(15442935-15442969)
chr6 (132-198)||(15962130-15962196)
chr6 (133-202)||(317912-317981)
chr6 (149-202)||(543551-543604)
chr6 (149-202)||(2616063-2616116)
chr6 (149-202)||(8680895-8680948)
chr6 (149-198)||(11129320-11129369)
chr6 (149-202)||(15116791-15116844)
chr6 (149-198)||(17321386-17321435)
chr6 (149-198)||(17321519-17321568)
chr6 (24-57)||(20897524-20897557)
chr6 (149-202)||(31166989-31167042)
chr6 (149-197)||(3276186-3276234)
chr6 (149-197)||(10910796-10910844)
chr6 (26-58)||(23628799-23628831)
chr6 (24-56)||(24901238-24901270)
chr6 (149-197)||(24901358-24901406)
chr6 (149-197)||(25137113-25137161)
chr6 (149-201)||(31398370-31398422)
chr6 (16-56)||(34582520-34582560)
chr6 (25-56)||(1007124-1007155)
chr6 (25-56)||(1007478-1007509)
chr6 (25-56)||(3276323-3276354)
chr6 (25-56)||(3414387-3414418)
chr6 (25-56)||(3968645-3968676)
chr6 (149-192)||(3968765-3968808)
chr6 (25-56)||(3968978-3969009)
chr6 (133-176)||(5286689-5286732)
chr6 (25-56)||(6412218-6412249)
chr6 (25-56)||(6412548-6412579)
chr6 (25-56)||(8170120-8170151)
chr6 (25-56)||(10910933-10910964)
chr6 (25-56)||(12299109-12299140)
chr6 (25-56)||(12757610-12757641)
chr6 (25-56)||(13268109-13268140)
chr6 (25-56)||(17765009-17765040)
chr6 (150-197)||(18024131-18024178)
chr6 (25-56)||(18024344-18024375)
chr6 (25-56)||(19321100-19321131)
chr6 (25-56)||(19690393-19690424)
chr6 (25-56)||(20467687-20467718)
chr6 (25-56)||(21147404-21147435)
chr6 (25-56)||(21385251-21385282)
chr6 (25-56)||(21385553-21385584)
chr6 (25-56)||(21994372-21994403)
chr6 (25-56)||(22543354-22543385)
chr6 (25-56)||(22543687-22543718)
chr6 (25-56)||(23502237-23502268)
chr6 (25-56)||(25137326-25137357)
chr6 (25-56)||(31198615-31198646)
chr6 (149-195)||(12757771-12757817)
chr6 (149-195)||(14656023-14656069)
chr6 (14-56)||(15962358-15962400)
chr6 (28-58)||(27765143-27765173)
chr6 (149-202)||(494590-494643)
chr6 (149-202)||(6591269-6591322)
chr6 (149-202)||(7324021-7324074)
chr6 (27-56)||(13617531-13617560)
chr6 (25-58)||(14655903-14655936)
chr6 (149-202)||(15076032-15076085)
chr6 (23-56)||(17771909-17771942)
chr6 (23-56)||(19267563-19267596)
chr6 (27-56)||(19320769-19320798)
chr6 (24-57)||(21165245-21165278)
chr6 (149-202)||(30928873-30928926)
chr6 (24-56)||(494404-494436)
chr6 (25-57)||(2615872-2615904)
chr6 (25-57)||(3276367-3276399)
chr6 (153-197)||(8169985-8170029)
chr6 (28-56)||(12298825-12298853)
chr6 (24-56)||(13268429-13268461)
chr6 (25-57)||(16995451-16995483)
chr6 (133-185)||(17772016-17772068)
chr6 (25-57)||(18810532-18810564)
chr6 (24-56)||(19296376-19296408)
chr6 (24-56)||(19690728-19690760)
chr6 (25-57)||(21953206-21953238)
chr6 (149-189)||(25121337-25121377)
chr6 (149-197)||(30479179-30479227)
chr6 (24-56)||(31167169-31167201)
chr6 (25-57)||(34582860-34582892)
[»] chr2 (137 HSPs)
chr2 (152-238)||(43597294-43597379)
chr2 (152-202)||(32691434-32691484)
chr2 (133-202)||(24483501-24483570)
chr2 (149-197)||(1295379-1295427)
chr2 (149-197)||(4424015-4424063)
chr2 (149-197)||(13215257-13215305)
chr2 (149-197)||(16523109-16523157)
chr2 (149-197)||(23732161-23732209)
chr2 (149-197)||(27109162-27109210)
chr2 (149-197)||(37910952-37911000)
chr2 (149-197)||(40125086-40125134)
chr2 (138-197)||(34317907-34317966)
chr2 (152-202)||(43592167-43592217)
chr2 (152-202)||(45442435-45442485)
chr2 (149-202)||(3838091-3838144)
chr2 (133-202)||(7814434-7814503)
chr2 (133-202)||(7814567-7814636)
chr2 (133-202)||(8046432-8046501)
chr2 (149-202)||(17541604-17541657)
chr2 (149-202)||(19183902-19183955)
chr2 (149-202)||(23989955-23990008)
chr2 (149-202)||(24483650-24483703)
chr2 (133-198)||(26238914-26238979)
chr2 (149-202)||(26814056-26814109)
chr2 (149-202)||(35155412-35155465)
chr2 (149-202)||(37271930-37271983)
chr2 (149-202)||(38980081-38980134)
chr2 (133-202)||(43710482-43710551)
chr2 (149-197)||(1138102-1138150)
chr2 (149-197)||(4842951-4842999)
chr2 (149-197)||(10671750-10671798)
chr2 (149-197)||(20939157-20939205)
chr2 (149-197)||(25750798-25750846)
chr2 (149-197)||(31909311-31909359)
chr2 (149-197)||(35686173-35686221)
chr2 (149-197)||(38231551-38231599)
chr2 (149-197)||(43672052-43672100)
chr2 (138-197)||(3832380-3832439)
chr2 (138-197)||(5164328-5164387)
chr2 (138-197)||(34963993-34964052)
chr2 (152-202)||(31326080-31326129)
chr2 (152-202)||(44993887-44993937)
chr2 (23-56)||(146659-146692)
chr2 (148-197)||(4042722-4042771)
chr2 (23-56)||(5335009-5335042)
chr2 (149-198)||(5790730-5790779)
chr2 (25-58)||(10671630-10671663)
chr2 (149-202)||(14392958-14393011)
chr2 (149-202)||(16900014-16900067)
chr2 (149-202)||(16993405-16993458)
chr2 (23-56)||(20131650-20131683)
chr2 (149-202)||(20658178-20658231)
chr2 (25-58)||(30215838-30215871)
chr2 (149-202)||(38731946-38731999)
chr2 (149-202)||(40302095-40302148)
chr2 (149-202)||(43789019-43789072)
chr2 (149-197)||(4794250-4794298)
chr2 (24-56)||(5334750-5334782)
chr2 (149-197)||(13850640-13850688)
chr2 (150-202)||(33732979-33733031)
chr2 (24-56)||(34964128-34964160)
chr2 (24-56)||(40124965-40124997)
chr2 (24-56)||(42695867-42695899)
chr2 (149-197)||(44559241-44559289)
chr2 (149-192)||(2481313-2481356)
chr2 (25-56)||(2481526-2481557)
chr2 (25-56)||(4423895-4423926)
chr2 (25-56)||(4424154-4424185)
chr2 (25-56)||(13215060-13215091)
chr2 (25-56)||(14003409-14003440)
chr2 (25-56)||(14003711-14003742)
chr2 (25-56)||(15842792-15842823)
chr2 (25-56)||(16522991-16523022)
chr2 (25-56)||(16523294-16523325)
chr2 (25-56)||(16673411-16673442)
chr2 (25-56)||(16673740-16673771)
chr2 (25-56)||(18113089-18113120)
chr2 (25-56)||(20131317-20131348)
chr2 (25-56)||(24358616-24358647)
chr2 (25-56)||(25705085-25705116)
chr2 (25-56)||(25705418-25705449)
chr2 (25-56)||(29859841-29859872)
chr2 (25-56)||(30215422-30215453)
chr2 (25-56)||(31644841-31644872)
chr2 (25-56)||(31909447-31909478)
chr2 (25-56)||(33576086-33576117)
chr2 (150-197)||(36815666-36815713)
chr2 (25-56)||(37228733-37228764)
chr2 (25-56)||(37911089-37911120)
chr2 (25-56)||(41451837-41451868)
chr2 (149-192)||(41451957-41452000)
chr2 (25-56)||(44559062-44559093)
chr2 (14-56)||(1137970-1138012)
chr2 (146-192)||(1696238-1696284)
chr2 (147-197)||(7121069-7121119)
chr2 (26-56)||(20939294-20939324)
chr2 (28-58)||(37229009-37229039)
chr2 (24-58)||(38979888-38979922)
chr2 (27-56)||(146328-146357)
chr2 (149-198)||(1497776-1497825)
chr2 (152-197)||(3172141-3172186)
chr2 (152-197)||(3172289-3172334)
chr2 (23-56)||(9195052-9195085)
chr2 (23-56)||(10375038-10375071)
chr2 (133-202)||(10665086-10665155)
chr2 (157-198)||(13802618-13802659)
chr2 (149-202)||(22881798-22881851)
chr2 (27-56)||(25300009-25300038)
chr2 (149-202)||(25954254-25954307)
chr2 (149-202)||(26707990-26708043)
chr2 (23-56)||(36806865-36806898)
chr2 (149-202)||(40786579-40786632)
chr2 (27-56)||(44559378-44559407)
chr2 (149-202)||(44985740-44985793)
chr2 (25-57)||(1777469-1777501)
chr2 (25-57)||(2412455-2412487)
chr2 (28-56)||(3832606-3832634)
chr2 (24-56)||(4042859-4042891)
chr2 (24-56)||(5790868-5790900)
chr2 (24-56)||(11713484-11713516)
chr2 (151-191)||(11788174-11788214)
chr2 (150-198)||(12835446-12835494)
chr2 (28-56)||(15842464-15842492)
chr2 (149-197)||(18113209-18113257)
chr2 (24-56)||(18113423-18113455)
chr2 (25-57)||(25977870-25977902)
chr2 (25-57)||(25979278-25979310)
chr2 (24-56)||(26813865-26813897)
chr2 (24-56)||(27109072-27109104)
chr2 (149-197)||(29182288-29182336)
chr2 (28-56)||(29859490-29859518)
chr2 (20-56)||(32476090-32476126)
chr2 (24-56)||(33733210-33733242)
chr2 (24-56)||(34317797-34317829)
chr2 (24-56)||(34318052-34318084)
chr2 (24-56)||(41791281-41791313)
chr2 (149-197)||(42695988-42696036)
[»] scaffold0119 (2 HSPs)
scaffold0119 (149-197)||(16843-16891)
scaffold0119 (24-58)||(16723-16757)
[»] scaffold0210 (1 HSPs)
scaffold0210 (133-202)||(14799-14868)
[»] scaffold0684 (2 HSPs)
scaffold0684 (149-197)||(2415-2463)
scaffold0684 (25-56)||(2629-2660)
[»] scaffold0085 (1 HSPs)
scaffold0085 (149-197)||(34917-34965)
[»] scaffold0001 (4 HSPs)
scaffold0001 (148-196)||(148006-148054)
scaffold0001 (25-56)||(148251-148282)
scaffold0001 (24-57)||(119592-119625)
scaffold0001 (25-57)||(121012-121044)
[»] scaffold0003 (1 HSPs)
scaffold0003 (152-202)||(366104-366154)
[»] scaffold0712 (1 HSPs)
scaffold0712 (149-202)||(5329-5382)
[»] scaffold0709 (1 HSPs)
scaffold0709 (149-202)||(5349-5402)
[»] scaffold0373 (1 HSPs)
scaffold0373 (149-202)||(8667-8720)
[»] scaffold0370 (1 HSPs)
scaffold0370 (149-202)||(117-170)
[»] scaffold0105 (2 HSPs)
scaffold0105 (154-242)||(17752-17839)
scaffold0105 (24-56)||(17935-17967)
[»] scaffold0007 (2 HSPs)
scaffold0007 (22-56)||(2852-2886)
scaffold0007 (149-197)||(2622-2670)
[»] scaffold0535 (1 HSPs)
scaffold0535 (153-202)||(8856-8905)
[»] scaffold0472 (1 HSPs)
scaffold0472 (138-191)||(7054-7107)
[»] scaffold0347 (2 HSPs)
scaffold0347 (149-202)||(4141-4194)
scaffold0347 (24-56)||(4281-4313)
[»] scaffold0204 (1 HSPs)
scaffold0204 (149-198)||(17245-17294)
[»] scaffold0179 (1 HSPs)
scaffold0179 (133-202)||(3120-3189)
[»] scaffold0159 (1 HSPs)
scaffold0159 (149-198)||(35103-35152)
[»] scaffold0051 (1 HSPs)
scaffold0051 (153-202)||(5534-5583)
[»] scaffold0021 (1 HSPs)
scaffold0021 (149-202)||(12302-12355)
[»] scaffold0106 (1 HSPs)
scaffold0106 (25-57)||(30934-30966)
[»] scaffold0026 (3 HSPs)
scaffold0026 (149-197)||(82461-82509)
scaffold0026 (25-56)||(82675-82706)
scaffold0026 (25-55)||(82341-82371)
[»] scaffold0011 (1 HSPs)
scaffold0011 (149-197)||(189448-189496)
[»] scaffold0160 (1 HSPs)
scaffold0160 (25-56)||(27333-27364)
[»] scaffold0078 (2 HSPs)
scaffold0078 (25-56)||(3752-3783)
scaffold0078 (149-197)||(3871-3918)
[»] scaffold0065 (2 HSPs)
scaffold0065 (147-202)||(3748-3803)
scaffold0065 (23-56)||(3530-3563)
[»] scaffold0024 (1 HSPs)
scaffold0024 (25-56)||(75733-75764)
[»] scaffold0005 (3 HSPs)
scaffold0005 (25-56)||(47925-47956)
scaffold0005 (25-56)||(223141-223172)
scaffold0005 (28-56)||(48200-48228)
[»] scaffold1001 (1 HSPs)
scaffold1001 (152-202)||(2898-2948)
[»] scaffold0517 (2 HSPs)
scaffold0517 (23-57)||(10313-10347)
scaffold0517 (25-57)||(11549-11581)
[»] scaffold0337 (1 HSPs)
scaffold0337 (23-56)||(12523-12556)
[»] scaffold0123 (1 HSPs)
scaffold0123 (149-202)||(17871-17924)
[»] scaffold0056 (2 HSPs)
scaffold0056 (23-56)||(50047-50080)
scaffold0056 (23-56)||(55148-55181)
[»] scaffold0016 (1 HSPs)
scaffold0016 (149-202)||(10275-10328)
[»] scaffold0230 (1 HSPs)
scaffold0230 (25-57)||(458-490)
[»] scaffold0176 (1 HSPs)
scaffold0176 (149-197)||(21810-21858)
[»] scaffold0009 (1 HSPs)
scaffold0009 (25-57)||(202579-202611)


Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 151)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 146 - 238
Target Start/End: Original strand, 14496929 - 14497020
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||| ||||||||||    
14496929 cctcatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta-atttttgatccttgcaaaatattttgttttttaaaa 14497020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 14488837 - 14488887
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
14488837 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 14488887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 7578409 - 7578359
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
7578409 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 7578359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 29487989 - 29487939
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||    
29487989 ttttgtgatgatttgcatatgtggcacatgatgactgaaccctttttgtag 29487939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 33526175 - 33526260
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||| |||        ||||||||||||||||| ||||||||||    
33526175 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatag-tttttggtccttgcaaaatattttgttttttaaaa 33526260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 10755409 - 10755359
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
10755409 ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 10755359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 14238872 - 14238922
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||| |||||||||||||||||||||||    
14238872 ttttgtgatgatttgcatacgtggcacctgatgactgaacccattttgtag 14238922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 15719778 - 15719828
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
15719778 ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag 15719828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 43727308 - 43727258
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||| ||| |||||||||||||||||||||||||||||||    
43727308 ttttgtgatgatttggatacgtggcacatgatgactgaacccattttgtag 43727258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 18549307 - 18549376
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || || ||||||||||||||||||| |||||||||||||||| |||| |||||||||    
18549307 aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgacttaacctattttgtag 18549376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 32418576 - 32418507
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || || ||||||||||||||||||| |||||||||||||||| |||| |||||||||    
32418576 aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtag 32418507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 7326206 - 7326254
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
7326206 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 7326254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 7420350 - 7420398
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
7420350 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 7420398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 8298707 - 8298755
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
8298707 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 8298755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 28497374 - 28497422
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
28497374 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 28497422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 35115579 - 35115531
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||    
35115579 cacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt 35115531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 10873158 - 10873112
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||| | |||||||||||||||||||||||||||    
10873158 ttttgtgatgatttgcacacgtggcacatgatgactgaacccatttt 10873112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 148 - 202
Target Start/End: Original strand, 23360490 - 23360544
Alignment:
148 tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||| |||||||| ||||||| |||||| |||||||||    
23360490 tcacttttgtgatgatttgcacatgtggcatatgatgattgaacctattttgtag 23360544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 30337044 - 30337094
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||| | ||||||||||||||||||||||||    
30337044 ttttgtgatgatttgcatacgtggtatatgatgactgaacccattttgtag 30337094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 1163015 - 1163084
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
1163015 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 1163084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 1525929 - 1525982
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
1525929 cacttttgtgatgatttgcataagtggcacattataactgaaccaattttgtag 1525982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 2811561 - 2811610
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||| ||| |||||||||||||||| ||||||||||    
2811561 cacttttgtgatgatttgtatacgtggcacatgatgactaaacccatttt 2811610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 4017022 - 4017075
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
4017022 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 4017075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 4375809 - 4375862
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
4375809 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 4375862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6146829 - 6146776
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
6146829 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 6146776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 10776379 - 10776326
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||| |||| ||||||||| ||||||||||| |||||||||    
10776379 cacttttgtgatgattttcatacgtggcacattatgactgaaccaattttgtag 10776326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19494238 - 19494291
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
19494238 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 19494291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 21125918 - 21125849
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
21125918 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 21125849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 24187670 - 24187739
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || ||||||||||||||||||||||  |||||||| || |||||||| |||||||||    
24187670 aaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaattttgtag 24187739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 38930421 - 38930474
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
38930421 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 38930474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 40844414 - 40844329
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| |||||||||||||| ||| || |||||||||        ||||||||||||||||| ||||||||||    
40844414 ttttgtgatgatttgcatacgtggcacatgatgattgagccgattttgtag-tttttggtccttgcaaaatattttgttttttaaaa 40844329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 42429997 - 42429952
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||    
42429997 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 42429952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 43477391 - 43477306
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| | | ||||||||||||||||| |||||||||        ||||||||||||||||| ||||||||||    
43477391 ttttgtgatgatttgcatacgagtcacatgatgactgaaccgattttgtag-tttttggtccttgcaaaatattttgttttttaaaa 43477306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 1778684 - 1778732
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||| ||||||    
1778684 cacttttgtgatgatttgcacacgtggcacatgatgactgaatccattt 1778732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4473824 - 4473872
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||| |||||||||    
4473824 cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 4473872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9175252 - 9175204
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |  |||||||||||||||||||||||||    
9175252 cacttttgtgatgatttgcacacatggcacatgatgactgaacccattt 9175204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13232318 - 13232366
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||    
13232318 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 13232366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 14847945 - 14847993
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||| |||||||||| |||||||||||    
14847945 cacttttgtgatgatttgcacatgtgacacatgatgagtgaacccattt 14847993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 15931149 - 15931101
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||    
15931149 cacttttgtgatgatttgcacacgtgtcacatgatgactgaacccattt 15931101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 23939667 - 23939715
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||| |||||||||||||||| |||||    
23939667 cacttttgtgatgatttgcacatgtgacacatgatgactgaactcattt 23939715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 44998145 - 44998097
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||| ||||||    
44998145 cacttttgtgatgatttgcacacgtggcacatgatgactgaatccattt 44998097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 2356002 - 2356053
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||||| |  || ||||||||||||||||||||||    
2356002 cctcacttttgtgatgatttgcacacatgacacatgatgactgaacccattt 2356053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 7272524 - 7272593
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| || ||| |||||||||||||||||||||| |||  |||| || |||||||| |||||||||    
7272524 aaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaattttgtag 7272593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 7326423 - 7326390
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
7326423 atggctaaaatatggttttggtccctgcaaatat 7326390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 8298585 - 8298618
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
8298585 atggctaaaatatggttttggtccctgcaaatat 8298618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 13232564 - 13232531
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
13232564 atggctaaaatatggttttggtccctgcaaatat 13232531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14495281 - 14495228
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||| | || |||||||| |||||||||    
14495281 cacttttgtgatgatttgcatacgtggcacctaataactgaaccaattttgtag 14495228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 21509814 - 21509867
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || ||||||||  ||||||||    
21509814 cacttttgtgatgatttgcatacgtggcacattataactgaaccagttttgtag 21509867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 22650570 - 22650639
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| || ||| |||||||||||||||||||||| ||||||||| || || ||| | |||||||||    
22650570 aaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataaccgaatcaattttgtag 22650639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 27117913 - 27117868
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | ||||||| ||||||||||||||||||    
27117913 ttttgtgatgatttgcacacgtggcacgtgatgactgaacccattt 27117868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 28398920 - 28398867
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
28398920 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 28398867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 30969719 - 30969686
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
30969719 atggctaaaatatggttttggtccctgcaaatat 30969686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 32040270 - 32040201
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||| | || | |||||| |||||||||    
32040270 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaattttgtag 32040201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 32195383 - 32195452
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || ||||||| ||||||| |||||| ||| |||||||||| |||||| |||||||||    
32195383 aaatagtctctgaccccacttttatgatgatatgcatacgtgacacatgatgattgaacctattttgtag 32195452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 33636442 - 33636495
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || || ||||| |||||||||    
33636442 cacttttgtgatgatttgcatacgtggcacattataacagaaccaattttgtag 33636495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 35346627 - 35346660
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
35346627 atggctaaaatatggttttggtccctgcaaatat 35346660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 146 - 191
Target Start/End: Complemental strand, 36044674 - 36044629
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaac 191  Q
    ||||||||||||||||||||||| |||||  |||||||||||||||    
36044674 cctcacttttgtgatgatttgcacatgtgatacatgatgactgaac 36044629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 1778563 - 1778595
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
1778563 tggctaaaatatggttttggtccctgcaaatat 1778595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 2728598 - 2728566
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
2728598 tggctaaaatatggttttggtccctgcaaatat 2728566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 4621234 - 4621186
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||  ||||||||||||||||||||||    
4621234 cacttttgtgatgatttgcacacgtcacacatgatgactgaacccattt 4621186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 7186005 - 7185973
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
7186005 tggctaaaatatggttttggtccctgcaaatat 7185973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10540569 - 10540616
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||| ||||||||||||    
10540569 cacttttgtgatgatttgcacacgtggcacatgatg-ctgaacccattt 10540616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 13779415 - 13779367
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||||||||||  |||||||| |||||    
13779415 cacttttgtgatgatttgcacatgtggcacatgtagactgaactcattt 13779367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 14489074 - 14489042
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
14489074 tggctaaaatatggttttggtccctgcaaatat 14489042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24090239 - 24090287
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||| |||| ||||| ||||||||||| ||||||||||    
24090239 cacttttgtgatgatatgcacatgtgacacatgatgaccgaacccattt 24090287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 29992181 - 29992133
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | ||| ||||||||||||||||||||||    
29992181 cacttttgtgatgatttacacacgtgacacatgatgactgaacccattt 29992133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 186
Target Start/End: Complemental strand, 33652438 - 33652398
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgac 186  Q
    ||||||||||||||||||||||| | |||||||||||||||    
33652438 cctcacttttgtgatgatttgcacacgtggcacatgatgac 33652398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 34963665 - 34963633
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
34963665 tggctaaaatatggttttggtccctgcaaatat 34963633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35097693 - 35097661
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
35097693 tggctaaaatatggttttggtccctgcaaatat 35097661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 37536420 - 37536388
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
37536420 tggctaaaatatggttttggtccctgcaaatat 37536388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 42132863 - 42132895
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
42132863 tggctaaaatatggttttggtccctgcaaatat 42132895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 42132984 - 42133032
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |  ||||||||||||||||||| |||||    
42132984 cacttttgtgatgatttgcacacctggcacatgatgactgaactcattt 42133032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 42133155 - 42133123
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
42133155 tggctaaaatatggttttggtccctgcaaatat 42133123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3512266 - 3512235
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3512266 ggctaaaatatggttttggtccctgcaaatat 3512235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 4710220 - 4710189
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
4710220 ggctaaaatatggttttggtccctgcaaatat 4710189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 6146634 - 6146677
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||||||||||||| ||||||||| || ||||||||    
6146634 cacttttgtgatgatttgcatacgtggcacattataactgaacc 6146677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 7420230 - 7420261
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
7420230 ggctaaaatatggttttggtccctgcaaatat 7420261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 8298975 - 8298944
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
8298975 ggctaaaatatggttttggtccctgcaaatat 8298944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 9496341 - 9496372
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
9496341 ggctaaaatatggttttggtccctgcaaatat 9496372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9496723 - 9496692
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
9496723 ggctaaaatatggttttggtccctgcaaatat 9496692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 10337119 - 10337150
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
10337119 ggctaaaatatggttttggtccctgcaaatat 10337150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10337449 - 10337418
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
10337449 ggctaaaatatggttttggtccctgcaaatat 10337418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10540782 - 10540751
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
10540782 ggctaaaatatggttttggtccctgcaaatat 10540751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 11019520 - 11019551
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
11019520 ggctaaaatatggttttggtccctgcaaatat 11019551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 11019857 - 11019826
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
11019857 ggctaaaatatggttttggtccctgcaaatat 11019826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 11976373 - 11976404
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
11976373 ggctaaaatatggttttggtccctgcaaatat 11976404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 11976616 - 11976573
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
11976616 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 11976573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 17073807 - 17073838
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
17073807 ggctaaaatatggttttggtccctgcaaatat 17073838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 17574463 - 17574432
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
17574463 ggctaaaatatggttttggtccctgcaaatat 17574432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20277692 - 20277723
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
20277692 ggctaaaatatggttttggtccctgcaaatat 20277723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20984146 - 20984177
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
20984146 ggctaaaatatggttttggtccctgcaaatat 20984177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21064319 - 21064350
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
21064319 ggctaaaatatggttttggtccctgcaaatat 21064350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25600230 - 25600261
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25600230 ggctaaaatatggttttggtccctgcaaatat 25600261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25702809 - 25702778
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25702809 ggctaaaatatggttttggtccctgcaaatat 25702778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 27117976 - 27117945
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
27117976 ggctaaaatatggttttggtccctgcaaatat 27117945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 28324061 - 28324014
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||| || | |||||||||||||| |||||||||||    
28324061 acttttgtgatgatttacacacgtggcacatgatgattgaacccattt 28324014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28346394 - 28346425
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
28346394 ggctaaaatatggttttggtccctgcaaatat 28346425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 28346758 - 28346727
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
28346758 ggctaaaatatggttttggtccctgcaaatat 28346727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 32725907 - 32725938
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
32725907 ggctaaaatatggttttggtccctgcaaatat 32725938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 32726271 - 32726240
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
32726271 ggctaaaatatggttttggtccctgcaaatat 32726240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 34963300 - 34963331
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
34963300 ggctaaaatatggttttggtccctgcaaatat 34963331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35097328 - 35097359
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35097328 ggctaaaatatggttttggtccctgcaaatat 35097359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 35346998 - 35346967
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35346998 ggctaaaatatggttttggtccctgcaaatat 35346967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 37536086 - 37536117
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
37536086 ggctaaaatatggttttggtccctgcaaatat 37536117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 40493072 - 40493115
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||||||||||||| ||||||||| || ||||||||    
40493072 cacttttgtgatgatttgcatacgtggcacattataactgaacc 40493115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 42430120 - 42430089
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
42430120 ggctaaaatatggttttggtccctgcaaatat 42430089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 55
Target Start/End: Original strand, 4473704 - 4473734
Alignment:
25 ggctaaaatatggttttggtccctgcaaata 55  Q
    |||||||||||||||||||||||||||||||    
4473704 ggctaaaatatggttttggtccctgcaaata 4473734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 58
Target Start/End: Original strand, 15719655 - 15719689
Alignment:
24 tggctaaaatatggttttggtccctgcaaatatat 58  Q
    |||||||||||||||||| ||||||||||||||||    
15719655 tggctaaaatatggttttagtccctgcaaatatat 15719689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 16643921 - 16643875
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||| ||||||||| || |||||||| |||||    
16643921 ttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 16643875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 19963119 - 19963169
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||| | ||||| |||||||| |||||||||    
19963119 ttttgtgatgatttgcatacgtggtatatgataactgaaccgattttgtag 19963169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 24090487 - 24090457
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
24090487 gctaaaatatggttttggtccctgcaaatat 24090457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 35143724 - 35143678
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||| |||||||||||| || ||||| |||||    
35143724 ttttgtgatgatttgcataagtggcacatgataaccgaaccgatttt 35143678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 1162907 - 1162940
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
1162907 atggctaaaatatggttttagtccctgcaaatat 1162940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 1408235 - 1408186
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| |||||| || || |||||||| |||||    
1408235 cacttttgtgatgatttgcatacgtggcatattataactgaaccaatttt 1408186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 4375690 - 4375723
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
4375690 atggctaaaatatggttttagtccctgcaaatat 4375723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 4621356 - 4621323
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| ||||||||||||||||||||    
4621356 atggctaaaatatagttttggtccctgcaaatat 4621323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 9832435 - 9832390
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||| || |||||||||||||||| || ||||||||    
9832435 ttttgtgatgatttacacatgtggcacatgatgaatgtacccattt 9832390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 16789254 - 16789201
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
16789254 cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag 16789201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 16789371 - 16789338
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
16789371 atggctaaaatatggttttagtccctgcaaatat 16789338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 22917808 - 22917759
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
22917808 cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 22917759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 25131228 - 25131281
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||| ||| ||||| || |||||||| |||||||||    
25131228 cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag 25131281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 25702749 - 25702708
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaa 190  Q
    |||||||||||| ||||||| | |||||||||||||||||||    
25702749 cacttttgtgataatttgcacacgtggcacatgatgactgaa 25702708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 28998053 - 28998020
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||| ||||||||||||||||||||    
28998053 tggctaaaatatgtttttggtccctgcaaatata 28998020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 33526050 - 33526083
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
33526050 atggctaaaatatggttttagtccctgcaaatat 33526083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 40066597 - 40066662
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||  || ||||||| |||||||||||||| ||| ||||| || |||||||| |||||    
40066597 aaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaatttt 40066662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 1385614 - 1385582
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||| ||||||||||||||||||||||||||||    
1385614 ggcttaaatatggttttggtccctgcaaatata 1385582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 1420501 - 1420469
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
1420501 ggctaaaatatgtttttggtccctgcaaatata 1420469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 1685234 - 1685274
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactga 189  Q
    |||||||||||||||||||||| ||||||||| || |||||    
1685234 cacttttgtgatgatttgcatacgtggcacattataactga 1685274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 7272415 - 7272451
Alignment:
20 ttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| ||||||||||||||||| ||||||||||||||    
7272415 ttcaaggctaaaatatggttttagtccctgcaaatat 7272451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 10717121 - 10717153
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
10717121 ggctaaaatatgcttttggtccctgcaaatata 10717153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 10718507 - 10718475
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
10718507 ggctaaaatatgcttttggtccctgcaaatata 10718475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 10776500 - 10776468
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
10776500 tggctaaaatatggttttagtccctgcaaatat 10776468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 10873281 - 10873249
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||| ||||||||||    
10873281 tggctaaaatatggttttggtctctgcaaatat 10873249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 11976733 - 11976705
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
11976733 taaaatatggttttggtccctgcaaatat 11976705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13155006 - 13155054
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||  ||||||||| | ||||||||||||||||||| ||||||    
13155006 cacttttgtattgatttgcacacgtggcacatgatgactgaatccattt 13155054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 13232201 - 13232229
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
13232201 taaaatatggttttggtccctgcaaatat 13232229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 17074048 - 17074000
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||| |||||||||||||||| |||||    
17074048 cacttttatgatgatttgcacacgtgacacatgatgactgaactcattt 17074000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 17574105 - 17574133
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
17574105 taaaatatggttttggtccctgcaaatat 17574133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 17574222 - 17574270
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||| |||||||||||||||| |||||    
17574222 cacttttatgatgatttgcacacgtgacacatgatgactgaactcattt 17574270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20277812 - 20277860
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||| | | |||||||||||| ||||||| |||||    
20277812 cacttttgtgatgatttgaacacgtggcacatgataactgaactcattt 20277860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 21064439 - 21064487
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||| | | |||||||||||| ||||||| |||||    
21064439 cacttttgtgatgatttgaacacgtggcacatgataactgaactcattt 21064487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 23939546 - 23939578
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||| ||||||||||    
23939546 tggctaaaatatggttttggtcactgcaaatat 23939578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24814825 - 24814873
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||| |||||||||| | || |||||||||||||||| ||||||    
24814825 cacttttgttatgatttgcacacgtagcacatgatgactgaatccattt 24814873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 25600351 - 25600399
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |  || |||||||||||||||| |||||    
25600351 cacttttgtgatgatttgcacacatgacacatgatgactgaactcattt 25600399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 28398755 - 28398787
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
28398755 tggctaaaatatggttttagtccctgcaaatat 28398787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 32195279 - 32195311
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||| |||||||    
32195279 tggctaaaatatggttttggtccctacaaatat 32195311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 54
Target Start/End: Complemental strand, 36044791 - 36044763
Alignment:
26 gctaaaatatggttttggtccctgcaaat 54  Q
    |||||||||||||||||||||||||||||    
36044791 gctaaaatatggttttggtccctgcaaat 36044763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 36588222 - 36588254
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
36588222 ggctaaaatatgcttttggtccctgcaaatata 36588254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 38456789 - 38456757
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
38456789 ggctaaaatatgcttttggtccctgcaaatata 38456757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40066821 - 40066789
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
40066821 tggctaaaatatggttttagtccctgcaaatat 40066789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 40844155 - 40844187
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
40844155 tggctaaaatatggttttagtccctgcaaatat 40844187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 175)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 202
Target Start/End: Complemental strand, 45313760 - 45313690
Alignment:
132 gaaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||| || ||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||    
45313760 gaaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacccattttgtag 45313690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 238
Target Start/End: Complemental strand, 4814798 - 4814694
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttatttt 232  Q
    |||||||| ||  ||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||        ||||||||||||||||| ||||    
4814798 aaatagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtag-tttttggtccttgcaaaatattttgtttt 4814700  T
233 ttaaaa 238  Q
    ||||||    
4814699 ttaaaa 4814694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 43440614 - 43440664
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
43440614 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 43440664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 3830253 - 3830303
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||| ||||||||||    
3830253 ttttgtgatgatttgcatacgtggcacatgatgactgaactcattttgtag 3830303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 4513499 - 4513449
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
4513499 ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 4513449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 15016625 - 15016575
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||    
15016625 ttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtag 15016575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 30552266 - 30552316
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||||||    
30552266 ttttatgatgatttgcatacgtggcacatgatgactgaacccattttgtag 30552316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 46186648 - 46186598
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||    
46186648 ttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtag 46186598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 51759942 - 51759992
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||| |||||||||||||    
51759942 ttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtag 51759992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 53701481 - 53701531
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
53701481 ttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtag 53701531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 3152008 - 3151939
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
3152008 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 3151939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 8510318 - 8510387
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
8510318 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 8510387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 35565615 - 35565676
Alignment:
136 tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||| ||  |||||||||||||||||||| | ||||||||||||||||||||||||||    
35565615 tagtctctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35565676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 36732758 - 36732803
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaaccca 194  Q
    |||||||||||||||||||| |||||||||||||||||||||||||    
36732758 cacttttgtgatgatttgcacatgtggcacatgatgactgaaccca 36732803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 39436989 - 39436936
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||||| || |||||||| |||||||||    
39436989 cacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag 39436936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 51058709 - 51058758
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||||||| |||||||||||||||| ||||||    
51058709 cacttttgtgatgatttgcatatgtgacacatgatgactgaactcatttt 51058758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 1721207 - 1721255
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |||||||||||||||| |||||||||||    
1721207 cacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt 1721255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 2486782 - 2486734
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
2486782 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 2486734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4034837 - 4034885
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
4034837 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 4034885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9262034 - 9261986
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
9262034 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 9261986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9596975 - 9596927
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||| ||||||||||||| ||||||||||||||||||||||||||    
9596975 cacttttgagatgatttgcatacgtggcacatgatgactgaacccattt 9596927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 10778612 - 10778560
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||||||||||||| || |||||||| |||||||||    
10778612 acttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag 10778560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 20405103 - 20405055
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||    
20405103 cacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt 20405055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20644625 - 20644673
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |||||||||||||||| |||||||||||    
20644625 cacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt 20644673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35177375 - 35177423
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
35177375 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35177423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 40277942 - 40277990
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
40277942 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40277990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 47114697 - 47114646
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||||| | ||| ||||||||||||||||||||||    
47114697 cctcacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 47114646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 15286382 - 15286332
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||| |||| |||||||||    
15286382 ttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtag 15286332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 45313874 - 45313832
Alignment:
14 aataacttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||| ||||||||||||||||||||||||||||||||||    
45313874 aataactttatggctaaaatatggttttggtccctgcaaatat 45313832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 50196420 - 50196470
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||| |||| |||||    
50196420 ttttgtgatgatttgcatacgtggcacatgatgactgaacacattctgtag 50196470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 51500564 - 51500514
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| ||||||||||||| |||||||||||||    
51500564 ttttgtgatgatttgcatacgtgacacatgatgactggacccattttgtag 51500514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 4950248 - 4950195
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
4950248 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 4950195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 7518344 - 7518275
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||| ||| |||||||||||||||||||||| ||| ||||| || |||||| | |||||||||    
7518344 aaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaaacaattttgtag 7518275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 13584123 - 13584176
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
13584123 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 13584176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 19656784 - 19656731
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
19656784 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 19656731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 21159697 - 21159644
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
21159697 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 21159644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 22156049 - 22156102
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
22156049 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 22156102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 28427505 - 28427436
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || ||||||||||||||||||||||  |||||||| || |||||||| |||||||||    
28427505 aaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtag 28427436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 30130260 - 30130329
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||| ||| |||||||||||||||||||||| ||| ||||| ||  ||||||| |||||||||    
30130260 aaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaattttgtag 30130329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 37506986 - 37507039
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
37506986 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 37507039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 40370465 - 40370420
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||    
40370465 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40370420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 7957107 - 7957059
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||| ||||    
7957107 cacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt 7957059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 11463361 - 11463313
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||||||||||||||||||||||||||    
11463361 cacttttttgatgatttgcacacgtggcacatgatgactgaacccattt 11463313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 201
Target Start/End: Original strand, 16123244 - 16123312
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 201  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||    
16123244 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta 16123312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 30034352 - 30034304
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||| ||||    
30034352 cacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt 30034304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35407559 - 35407607
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||| | | ||||||||||||||||||||||||||    
35407559 cacttttgtgatgatttgtacaggtggcacatgatgactgaacccattt 35407607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35533397 - 35533445
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
35533397 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 35533445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 45006006 - 45006054
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||    
45006006 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 45006054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 146 - 202
Target Start/End: Complemental strand, 53719210 - 53719154
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||||| | |||  |||||||||||||| |||||||||||    
53719210 cctcacttttgtgatgatttgcacacgtgatacatgatgactgaatccattttgtag 53719154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 14772332 - 14772383
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgt 200  Q
    |||||||||||||||||| | | |||||||||||||| ||||||||||||||    
14772332 cacttttgtgatgatttgtacacgtggcacatgatgattgaacccattttgt 14772383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 16679847 - 16679796
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||| ||||||||||||||||| | |||||||| |||||||||||||||||    
16679847 cctcatttttgtgatgatttgcacacgtggcacaagatgactgaacccattt 16679796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 196
Target Start/End: Original strand, 28418661 - 28418708
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatt 196  Q
    |||||||||||||||||||| | ||||||||||||||||||| |||||    
28418661 cacttttgtgatgatttgcacacgtggcacatgatgactgaatccatt 28418708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 29678278 - 29678219
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| |||||||||||||||||||| | |||||||| ||||||| |||||||||    
29678278 gtctctagccccacttttgtgatgatttgcacacgtggcacaagatgactaaacccattt 29678219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 38232491 - 38232440
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||| | | ||| ||||||||||||||||||||||    
38232491 cctcacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt 38232440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 18175909 - 18175959
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||| || |||||||| |||||||||    
18175909 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 18175959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 30268605 - 30268651
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||| ||| ||||||||||||||||| |||||    
30268605 ttttgtgatgatttgcatacgtgacacatgatgactgaaccgatttt 30268651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 275561 - 275614
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
275561 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 275614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 4034715 - 4034748
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
4034715 atggctaaaatatggttttggtccctgcaaatat 4034748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 10977097 - 10977150
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| |||| |||| || |||||||| |||||||||    
10977097 cacttttgtgatgatttgcatacgtggtacattataactgaaccaattttgtag 10977150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 198
Target Start/End: Complemental strand, 12673902 - 12673837
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
12673902 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 12673837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14633768 - 14633715
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||| |||||||||| ||||||||| || |||||||| |||||||||    
14633768 cacttttgtgaagatttgcatacgtggcacattataactgaaccaattttgtag 14633715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 15979336 - 15979369
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
15979336 atggctaaaatatggttttggtccctgcaaatat 15979369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 20757518 - 20757571
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||| ||||||||| || |||||||| |||||||||    
20757518 cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag 20757571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 20907338 - 20907285
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
20907338 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 20907285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 26090080 - 26090047
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
26090080 atggctaaaatatggttttggtccctgcaaatat 26090047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 27681324 - 27681357
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
27681324 atggctaaaatatggttttggtccctgcaaatat 27681357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 34238717 - 34238770
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| ||||||||||||| ||||||||| || |||||||| |||||||||    
34238717 cacttttgagatgatttgcatacgtggcacattataactgaaccaattttgtag 34238770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 39072094 - 39072041
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||| ||||||||| || |||||||| |||||||||    
39072094 cacttttgtgataatttgcatacgtggcacattataactgaaccaattttgtag 39072041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 39288780 - 39288727
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
39288780 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 39288727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 45161231 - 45161284
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
45161231 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 45161284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 49670719 - 49670666
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
49670719 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 49670666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 52342462 - 52342421
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaa 190  Q
    |||||||||||||||||||| | |||||||||||||||||||    
52342462 cacttttgtgatgatttgcacacgtggcacatgatgactgaa 52342421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 3387385 - 3387433
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |  ||||||||||||| |||||||||||    
3387385 cacttttgtgatgatttgcacacttggcacatgatgagtgaacccattt 3387433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 4035054 - 4035022
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
4035054 tggctaaaatatggttttggtccctgcaaatat 4035022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5345570 - 5345522
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||||| ||||||||| || |||||||| ||||    
5345570 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 5345522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 9603749 - 9603797
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| |||||||||||||||| |||||    
9603749 cacttttgtgatgatttgcacacgtgtcacatgatgactgaactcattt 9603797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 19844386 - 19844434
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| |||||||||| |||||||||||    
19844386 cacttttgtgatgatttgcacacgtgacacatgatgagtgaacccattt 19844434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 20405223 - 20405191
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||    
20405223 ggctaaaatatggttttggtccctgcaaatata 20405191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 22008891 - 22008859
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
22008891 tggctaaaatatggttttggtccctgcaaatat 22008859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25610011 - 25609963
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||| | | ||||||||||||||||||||||||||    
25610011 cacttttctgatgatttgaacacgtggcacatgatgactgaacccattt 25609963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26089729 - 26089761
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
26089729 tggctaaaatatggttttggtccctgcaaatat 26089761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 29686658 - 29686706
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||| | | |||||||||||||||| |||||||||    
29686658 cacttttgtgatgatttgaacacgtggcacatgatgactaaacccattt 29686706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 30106220 - 30106188
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||    
30106220 ggctaaaatatggttttggtccctgcaaatata 30106188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 193
Target Start/End: Complemental strand, 31480380 - 31480336
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaaccc 193  Q
    |||||||||||| ||||||| | ||||||||||||||||||||||    
31480380 cacttttgtgataatttgcacacgtggcacatgatgactgaaccc 31480336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 39820663 - 39820631
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||    
39820663 ggctaaaatatggttttggtccctgcaaatata 39820631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 43441269 - 43441301
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
43441269 tggctaaaatatggttttggtccctgcaaatat 43441301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 47005274 - 47005322
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||| |||||||||| ||||||||||    
47005274 cacttttgtgatgatttgcacacgtggtacatgatgaccgaacccattt 47005322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 47433868 - 47433836
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||    
47433868 ggctaaaatatggttttggtccctgcaaatata 47433836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 49323781 - 49323813
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
49323781 tggctaaaatatggttttggtccctgcaaatat 49323813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 49324027 - 49323983
Alignment:
148 tcacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    ||||||||||||| ||||||| | |||||||||||||||||||||    
49324027 tcacttttgtgataatttgcacacgtggcacatgatgactgaacc 49323983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 52956580 - 52956532
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | ||| ||||||||||||||||||||||    
52956580 cacttttgtgatgatttacacacgtgacacatgatgactgaacccattt 52956532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 53113503 - 53113551
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |  |||||||||||||||||||| ||||    
53113503 cacttttgtgatgatttgcacacatggcacatgatgactgaacctattt 53113551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 474044 - 474075
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
474044 ggctaaaatatggttttggtccctgcaaatat 474075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 474408 - 474377
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
474408 ggctaaaatatggttttggtccctgcaaatat 474377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1721452 - 1721421
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1721452 ggctaaaatatggttttggtccctgcaaatat 1721421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 8940405 - 8940362
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
8940405 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 8940362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9262155 - 9262124
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
9262155 ggctaaaatatggttttggtccctgcaaatat 9262124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9603919 - 9603888
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
9603919 ggctaaaatatggttttggtccctgcaaatat 9603888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12740907 - 12740938
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12740907 ggctaaaatatggttttggtccctgcaaatat 12740938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 12741027 - 12741070
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
12741027 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 12741070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12741271 - 12741240
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12741271 ggctaaaatatggttttggtccctgcaaatat 12741240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14772211 - 14772242
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14772211 ggctaaaatatggttttggtccctgcaaatat 14772242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19844581 - 19844550
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19844581 ggctaaaatatggttttggtccctgcaaatat 19844550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21553889 - 21553920
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
21553889 ggctaaaatatggttttggtccctgcaaatat 21553920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 22008770 - 22008727
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
22008770 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 22008727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 22016288 - 22016245
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
22016288 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 22016245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25615975 - 25616006
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25615975 ggctaaaatatggttttggtccctgcaaatat 25616006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28552021 - 28552052
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
28552021 ggctaaaatatggttttggtccctgcaaatat 28552052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 28552383 - 28552352
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
28552383 ggctaaaatatggttttggtccctgcaaatat 28552352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29490743 - 29490712
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
29490743 ggctaaaatatggttttggtccctgcaaatat 29490712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 31480136 - 31480167
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
31480136 ggctaaaatatggttttggtccctgcaaatat 31480167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 39132906 - 39132875
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
39132906 ggctaaaatatggttttggtccctgcaaatat 39132875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 40370589 - 40370558
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
40370589 ggctaaaatatggttttggtccctgcaaatat 40370558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 40545564 - 40545595
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
40545564 ggctaaaatatggttttggtccctgcaaatat 40545595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 45002021 - 45002052
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
45002021 ggctaaaatatggttttggtccctgcaaatat 45002052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 45002141 - 45002184
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
45002141 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 45002184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47005154 - 47005185
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
47005154 ggctaaaatatggttttggtccctgcaaatat 47005185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 47005519 - 47005488
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
47005519 ggctaaaatatggttttggtccctgcaaatat 47005488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47336228 - 47336259
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
47336228 ggctaaaatatggttttggtccctgcaaatat 47336259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 47336581 - 47336550
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
47336581 ggctaaaatatggttttggtccctgcaaatat 47336550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 47901919 - 47901962
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||||||||||||| ||||||||| || ||||||||    
47901919 cacttttgtgatgatttgcatacgtggcacattataactgaacc 47901962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 51550082 - 51550113
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
51550082 ggctaaaatatggttttggtccctgcaaatat 51550113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 51550446 - 51550415
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
51550446 ggctaaaatatggttttggtccctgcaaatat 51550415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 52342195 - 52342226
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
52342195 ggctaaaatatggttttggtccctgcaaatat 52342226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 53113443 - 53113474
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
53113443 ggctaaaatatggttttggtccctgcaaatat 53113474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 54608518 - 54608549
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
54608518 ggctaaaatatggttttggtccctgcaaatat 54608549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 54608863 - 54608832
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
54608863 ggctaaaatatggttttggtccctgcaaatat 54608832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 196
Target Start/End: Original strand, 54767291 - 54767338
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatt 196  Q
    |||||||||||||||||||  | ||| |||||||||||||||||||||    
54767291 cacttttgtgatgatttgctcacgtgacacatgatgactgaacccatt 54767338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 25610129 - 25610099
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
25610129 gctaaaatatggttttggtccctgcaaatat 25610099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 28418899 - 28418869
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
28418899 gctaaaatatggttttggtccctgcaaatat 28418869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 199
Target Start/End: Original strand, 29446074 - 29446124
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg 199  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| ||||||    
29446074 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg 29446124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 30426163 - 30426113
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||||| ||||| || ||| |||| |||||||||    
30426163 ttttgtgatgatttgcatatgtgacacattataactaaaccaattttgtag 30426113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Original strand, 36673083 - 36673121
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgact 187  Q
    ||||||||||||||||| |||| ||||||||||||||||    
36673083 cacttttgtgatgatttacatacgtggcacatgatgact 36673121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 36673244 - 36673214
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
36673244 gctaaaatatggttttggtccctgcaaatat 36673214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 46901222 - 46901272
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||| |||||||||||||| ||| |||||||| ||||||| ||||||||||    
46901222 ttttttgatgatttgcatacgtgacacatgataactgaactcattttgtag 46901272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 2486900 - 2486871
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
2486900 ctaaaatatggttttggtccctgcaaatat 2486871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 10976976 - 10977009
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
10976976 atggctaaaatatggttttagtccctgcaaatat 10977009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 20612780 - 20612727
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||  |||||||||    
20612780 cacttttgtgatgatttgcatacgtgacacattataactgaacaaattttgtag 20612727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 25710769 - 25710700
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  |  ||||||||||||||| || ||| ||||||||| || |||||||| |||||||||    
25710769 aaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttgtag 25710700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 26800008 - 26800057
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
26800008 cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 26800057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 29955418 - 29955471
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||  ||| ||||| || |||||||| |||||||||    
29955418 cacttttgtgatgatttgcattcgtgtcacattataactgaaccaattttgtag 29955471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 30004572 - 30004625
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||  ||| ||||| || |||||||| |||||||||    
30004572 cacttttgtgatgatttgcatgcgtgacacattataactgaaccaattttgtag 30004625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 252
Target Start/End: Original strand, 32635673 - 32635714
Alignment:
211 tccttgcaaaatattttattttttaaaatagttcatggcccc 252  Q
    ||||||||||||||||| |||||||||||||| ||| |||||    
32635673 tccttgcaaaatattttgttttttaaaatagtccatagcccc 32635714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 40169534 - 40169481
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||| ||||| ||||||||| || |||||| | |||||||||    
40169534 cacttttgtgatgattcgcatacgtggcacattataactgaatcaattttgtag 40169481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 40370283 - 40370316
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||| |||||||||||||||||||    
40370283 atggctaaaatatgattttggtccctgcaaatat 40370316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 45320861 - 45320808
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || | |||||| |||||||||    
45320861 cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag 45320808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 248
Target Start/End: Original strand, 46724626 - 46724659
Alignment:
215 tgcaaaatattttattttttaaaatagttcatgg 248  Q
    ||||||||||||||||||| ||||||||||||||    
46724626 tgcaaaatattttatttttgaaaatagttcatgg 46724659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 52708677 - 52708644
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||| ||||||||||||||||||||    
52708677 tggctaaaatatgcttttggtccctgcaaatata 52708644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 863649 - 863621
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
863649 taaaatatggttttggtccctgcaaatat 863621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 7957227 - 7957195
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
7957227 tggctaaaatatgattttggtccctgcaaatat 7957195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 8510213 - 8510245
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
8510213 tggctaaaatatggttttagtccctgcaaatat 8510245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 8940522 - 8940494
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
8940522 taaaatatggttttggtccctgcaaatat 8940494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 9261788 - 9261820
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
9261788 tggctaaaatatgattttggtccctgcaaatat 9261820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 15016387 - 15016419
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
15016387 tggctaaaatatggttttagtccctgcaaatat 15016419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 19844264 - 19844296
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||| |||||||    
19844264 tggctaaaatatggttttggtccctacaaatat 19844296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 20644504 - 20644536
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||| ||||||||||||||||||||    
20644504 tggctaaaatatagttttggtccctgcaaatat 20644536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 20644876 - 20644844
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||||||||||| |||||||    
20644876 ggctaaaatatggttttggtccctgtaaatata 20644844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 25710871 - 25710839
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
25710871 tggctaaaatatggttttagtccctgcaaatat 25710839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 29678388 - 29678356
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
29678388 tggctaaaatatgattttggtccctgcaaatat 29678356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Original strand, 30128284 - 30128312
Alignment:
25 ggctaaaatatggttttggtccctgcaaa 53  Q
    |||||||||||||||||||||||||||||    
30128284 ggctaaaatatggttttggtccctgcaaa 30128312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 31480501 - 31480469
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||| ||||||||||||||||||    
31480501 tggctaaaatatggatttggtccctgcaaatat 31480469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 35565508 - 35565540
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||| ||||||||||||||    
35565508 ggctaaaatatggttttgttccctgcaaatata 35565540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 35569133 - 35569105
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
35569133 taaaatatggttttggtccctgcaaatat 35569105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 35936780 - 35936812
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||| ||||||||    
35936780 ggctaaaatatggttttggtccctacaaatata 35936812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 39132787 - 39132739
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| | |||||||||||||| |||||    
39132787 cacttttgtgatgatttgcacacgtgacgcatgatgactgaactcattt 39132739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40169655 - 40169623
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
40169655 tggctaaaatatggttttagtccctgcaaatat 40169623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 40477433 - 40477401
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
40477433 ggctaaaatatgattttggtccctgcaaatata 40477401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 40979479 - 40979531
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 201  Q
    |||||||||||||||||||||| ||| ||||| || |||||||  ||||||||    
40979479 cacttttgtgatgatttgcatacgtgtcacattataactgaactaattttgta 40979531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 44506582 - 44506614
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||| |||||||||||||||    
44506582 ggctaaaatatggttttagtccctgcaaatata 44506614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 44507858 - 44507826
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
44507858 ggctaaaatatgattttggtccctgcaaatata 44507826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 44802281 - 44802313
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
44802281 tggctaaaatatggttttagtccctgcaaatat 44802313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 46026076 - 46026108
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
46026076 ggctaaaatatgtttttggtccctgcaaatata 46026108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 46104343 - 46104375
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
46104343 ggctaaaatatgattttggtccctgcaaatata 46104375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 53121302 - 53121334
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
53121302 ggctaaaatatgtttttggtccctgcaaatata 53121334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 54437526 - 54437494
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
54437526 ggctaaaatatgtttttggtccctgcaaatata 54437494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 152 - 201
Target Start/End: Original strand, 8453 - 8502
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
8453 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 8502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 145)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 22099808 - 22099739
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || || ||||||||||||||||||| |||||||||||||||||||||||||||||||    
22099808 aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 22099739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 238
Target Start/End: Complemental strand, 29420434 - 29420330
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttatttt 232  Q
    |||||||||||  || ||||||||||||||| |||||| |||||||||||||| ||||||||||||||||        ||||||||||||||||| ||||    
29420434 aaatagtctctaaccccacttttgtgatgatatgcatacgtggcacatgatgattgaacccattttgtag-gaaaaggtccttgcaaaatattttgtttt 29420336  T
233 ttaaaa 238  Q
    ||||||    
29420335 ttaaaa 29420330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 45505770 - 45505724
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||    
45505770 ttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt 45505724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 45593347 - 45593397
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
45593347 ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 45593397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 51545848 - 51545798
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
51545848 ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 51545798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 32365197 - 32365266
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| || ||| || ||||||||||||||||||| ||||||||||||| ||||||| |||||||||    
32365197 aaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatggctgaaccgattttgtag 32365266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 34355067 - 34355136
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| || ||| |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
34355067 aaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 34355136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 36702119 - 36702172
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| ||||||||||| |||||||||    
36702119 cacttttgtgatgatttgcatacgtggcacattatgactgaaccaattttgtag 36702172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5203173 - 5203125
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||    
5203173 cacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt 5203125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5797700 - 5797652
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
5797700 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 5797652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 5827775 - 5827823
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||||||||||||||||||| ||||| |||||    
5827775 cacttttgtgatgatttgcatatgtggcacatgatgagtgaactcattt 5827823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 11692881 - 11692929
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| |||| ||||||||||||||||||||||||||    
11692881 cacttttgtgatgattttcatacgtggcacatgatgactgaacccattt 11692929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13530499 - 13530547
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
13530499 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 13530547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 24774307 - 24774259
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
24774307 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 24774259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25424192 - 25424144
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
25424192 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 25424144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 54208705 - 54208657
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
54208705 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 54208657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 52441882 - 52441932
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| ||| |||||||||||||||||||||||    
52441882 ttttgtgatgatttgcatacgtgacacgtgatgactgaacccattttgtag 52441932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 4279215 - 4279162
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
4279215 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 4279162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6827754 - 6827701
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
6827754 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 6827701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 16712574 - 16712521
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||||| || ||| |||| |||||||||    
16712574 cacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtag 16712521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 18830948 - 18831017
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| || |||||||||||||||||||||||||| ||| ||||| || |||||||| | |||||||    
18830948 aaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaactttgtag 18831017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 25358449 - 25358396
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| | | |||||||||||||||||||| ||||||||||    
25358449 cacttttgtgatgatttgaacacgtggcacatgatgactgaactcattttgtag 25358396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 34362026 - 34361973
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
34362026 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 34361973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 35415419 - 35415472
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
35415419 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 35415472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 50714446 - 50714393
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
50714446 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 50714393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 2034734 - 2034686
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||| ||||||    
2034734 cacttttgtgatgatttgcacacgtggcacatgatgactgaatccattt 2034686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4211621 - 4211669
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||| |||||||||||    
4211621 cacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt 4211669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 7642533 - 7642485
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
7642533 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 7642485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 146 - 194
Target Start/End: Complemental strand, 12791857 - 12791809
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaaccca 194  Q
    ||||||||||||||||||||||| | ||| |||||||||||||||||||    
12791857 cctcacttttgtgatgatttgcacacgtgacacatgatgactgaaccca 12791809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 19903381 - 19903429
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |||||||||||||||| |||||| ||||    
19903381 cacttttgtgatgatttgcacatgtggcacatgatgagtgaaccaattt 19903429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35119383 - 35119431
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||| |||||||||||||||||||||    
35119383 cacttttgtgatgatttgcacacgtggtacatgatgactgaacccattt 35119431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 36050406 - 36050454
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||| |||||||||||||||||||    
36050406 cacttttgtgatgatttgcacacgtggcatatgatgactgaacccattt 36050454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 194
Target Start/End: Original strand, 41439909 - 41439953
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaaccca 194  Q
    ||||||||||||||||||| | |||||||||||||||||||||||    
41439909 acttttgtgatgatttgcacacgtggcacatgatgactgaaccca 41439953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 43200090 - 43200138
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||| || |||||||||||||||||||    
43200090 cacttttgtgatgatttgcacatgtgacatatgatgactgaacccattt 43200138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 46115659 - 46115611
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||| |||||||||    
46115659 cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 46115611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 46128793 - 46128745
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||| |||||||||    
46128793 cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 46128745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 47022985 - 47022937
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||||||||||||||||||||||||||    
47022985 cacttttttgatgatttgcacacgtggcacatgatgactgaacccattt 47022937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 50822178 - 50822126
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
50822178 acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 50822126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 242
Target Start/End: Complemental strand, 8191264 - 8191177
Alignment:
154 ttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt 242  Q
    ||||||||||||||||| |||| ||||| ||||||||| ||||||||||        |||||||||||||| || ||||||||||||||    
8191264 ttgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag-aaaaaagtccttgcaaaatatattgttttttaaaatagt 8191177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 13073869 - 13073928
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| |||||||||||||||||||| | |||| |||||||||| ||||||||||    
13073869 gtctctggccccacttttgtgatgatttgcacacgtggtacatgatgaccgaacccattt 13073928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 42823982 - 42823923
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| || ||||||||||||||||| ||||| |||||||||||||||| |||||    
42823982 gtctctggccccatttttgtgatgatttgcacatgtgacacatgatgactgaactcattt 42823923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 244
Target Start/End: Original strand, 46292452 - 46292547
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagttc 244  Q
    |||||||||||||||||||| | ||| |||||||||||| || |||||||||||        ||| ||||||||||||| |||||  |||||||||    
46292452 cacttttgtgatgatttgcacacgtgacacatgatgactaaatccattttgtagaaaaatagtccctgcaaaatattttgtttttggaaatagttc 46292547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 47135898 - 47135941
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||||||||||| | |||||||||||||||||||||    
47135898 cacttttgtgatgatttgcacacgtggcacatgatgactgaacc 47135941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 2180451 - 2180401
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||  |||||||||||||||| |||||||||    
2180451 ttttgtgatgatttgcatacgtgagacatgatgactgaacctattttgtag 2180401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 6353518 - 6353476
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaac 191  Q
    ||||||||| |||||||||| ||||||||||||||||||||||    
6353518 cacttttgttatgatttgcacatgtggcacatgatgactgaac 6353476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 41346096 - 41346046
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||| || |||||||| |||||||||    
41346096 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 41346046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 41620136 - 41620086
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg 199  Q
    |||||||||||||||||||||| ||||||||| || |||||||| ||||||    
41620136 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 41620086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 51738351 - 51738309
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaac 191  Q
    |||||||||||||||||||| | ||||||||||||||||||||    
51738351 cacttttgtgatgatttgcacacgtggcacatgatgactgaac 51738309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5063123 - 5063176
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||| | || |||||| | |||||||||    
5063123 cacttttgtgatgatttgcatatgtggcacgttataactgaatcaattttgtag 5063176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 13479389 - 13479442
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
13479389 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 13479442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 14488064 - 14488019
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | |||||||||||||||||||| |||||    
14488064 ttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 14488019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 27008304 - 27008235
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
27008304 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag 27008235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 31560697 - 31560664
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
31560697 atggctaaaatatggttttggtccctgcaaatat 31560664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 42848393 - 42848360
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
42848393 atggctaaaatatggttttggtccctgcaaatat 42848360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 46292390 - 46292423
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
46292390 atggctaaaatatggttttggtccctgcaaatat 46292423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 51708908 - 51708855
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
51708908 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 51708855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 52017750 - 52017697
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| ||||||||||||| ||||||||| || |||||||| |||||||||    
52017750 cacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtag 52017697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 55482351 - 55482298
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || | |||||| |||||||||    
55482351 cacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtag 55482298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 123774 - 123722
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||| ||||||||||| ||||||||| || |||||||| |||||||||    
123774 acttttgtggtgatttgcatacgtggcacattataactgaaccaattttgtag 123722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 5827654 - 5827686
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
5827654 tggctaaaatatggttttggtccctgcaaatat 5827686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 13073758 - 13073790
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
13073758 tggctaaaatatggttttggtccctgcaaatat 13073790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 13074125 - 13074093
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||    
13074125 ggctaaaatatggttttggtccctgcaaatata 13074093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 19321860 - 19321828
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
19321860 tggctaaaatatggttttggtccctgcaaatat 19321828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 23245230 - 23245262
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
23245230 tggctaaaatatggttttggtccctgcaaatat 23245262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 26412585 - 26412553
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
26412585 tggctaaaatatggttttggtccctgcaaatat 26412553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 29380728 - 29380776
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||| |||||||||| | ||||||||||||||||||| ||||||    
29380728 cacttttgtaatgatttgcacacgtggcacatgatgactgaatccattt 29380776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 31812043 - 31812091
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||| ||||||||||||||||||||||    
31812043 cacttttatgatgatttgcacacgtgacacatgatgactgaacccattt 31812091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35464383 - 35464351
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
35464383 tggctaaaatatggttttggtccctgcaaatat 35464351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 41920964 - 41920912
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
41920964 acttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 41920912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 42824092 - 42824060
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
42824092 tggctaaaatatggttttggtccctgcaaatat 42824060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 46115413 - 46115445
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
46115413 tggctaaaatatggttttggtccctgcaaatat 46115445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 46128547 - 46128579
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
46128547 tggctaaaatatggttttggtccctgcaaatat 46128579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 51763082 - 51763034
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| || |||||||||||||||||||    
51763082 cacttttgtgatgatttgcacacgtgacaaatgatgactgaacccattt 51763034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 53308069 - 53308037
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
53308069 tggctaaaatatggttttggtccctgcaaatat 53308037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 4211561 - 4211592
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
4211561 ggctaaaatatggttttggtccctgcaaatat 4211592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 5827973 - 5827942
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
5827973 ggctaaaatatggttttggtccctgcaaatat 5827942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Complemental strand, 6353637 - 6353606
Alignment:
26 gctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||||||||||||||||||    
6353637 gctaaaatatggttttggtccctgcaaatata 6353606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 11693121 - 11693090
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
11693121 ggctaaaatatggttttggtccctgcaaatat 11693090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12152154 - 12152185
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12152154 ggctaaaatatggttttggtccctgcaaatat 12152185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12152493 - 12152462
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12152493 ggctaaaatatggttttggtccctgcaaatat 12152462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 13530713 - 13530682
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
13530713 ggctaaaatatggttttggtccctgcaaatat 13530682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13631228 - 13631259
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
13631228 ggctaaaatatggttttggtccctgcaaatat 13631259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 13631599 - 13631568
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
13631599 ggctaaaatatggttttggtccctgcaaatat 13631568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13764613 - 13764644
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
13764613 ggctaaaatatggttttggtccctgcaaatat 13764644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14487802 - 14487833
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14487802 ggctaaaatatggttttggtccctgcaaatat 14487833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 14488187 - 14488156
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14488187 ggctaaaatatggttttggtccctgcaaatat 14488156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14594206 - 14594237
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14594206 ggctaaaatatggttttggtccctgcaaatat 14594237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 14791806 - 14791775
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14791806 ggctaaaatatggttttggtccctgcaaatat 14791775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 24774045 - 24774076
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
24774045 ggctaaaatatggttttggtccctgcaaatat 24774076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25423924 - 25423955
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25423924 ggctaaaatatggttttggtccctgcaaatat 25423955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25424312 - 25424281
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25424312 ggctaaaatatggttttggtccctgcaaatat 25424281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29420537 - 29420506
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
29420537 ggctaaaatatggttttggtccctgcaaatat 29420506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 29499182 - 29499213
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
29499182 ggctaaaatatggttttggtccctgcaaatat 29499213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 30046792 - 30046761
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
30046792 ggctaaaatatggttttggtccctgcaaatat 30046761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 30061133 - 30061102
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
30061133 ggctaaaatatggttttggtccctgcaaatat 30061102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35119292 - 35119323
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35119292 ggctaaaatatggttttggtccctgcaaatat 35119323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35464018 - 35464049
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35464018 ggctaaaatatggttttggtccctgcaaatat 35464049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Complemental strand, 37557194 - 37557163
Alignment:
26 gctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||||||||||||||||||    
37557194 gctaaaatatggttttggtccctgcaaatata 37557163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 43231088 - 43231119
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
43231088 ggctaaaatatggttttggtccctgcaaatat 43231119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 43231389 - 43231358
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
43231389 ggctaaaatatggttttggtccctgcaaatat 43231358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 53915683 - 53915714
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
53915683 ggctaaaatatggttttggtccctgcaaatat 53915714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 53916047 - 53916016
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
53916047 ggctaaaatatggttttggtccctgcaaatat 53916016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 54903475 - 54903444
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
54903475 ggctaaaatatggttttggtccctgcaaatat 54903444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 19675681 - 19675647
Alignment:
23 atggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||| ||||||||||||||||||||    
19675681 atggctaaaatatgcttttggtccctgcaaatata 19675647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 43368586 - 43368632
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||| |||||||||||||| ||||||||| |||| ||||||||||||    
43368586 ttttatgatgatttgcatacgtggcacataatgaatgaacccatttt 43368632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 47136170 - 47136140
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
47136170 gctaaaatatggttttggtccctgcaaatat 47136140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 58
Target Start/End: Original strand, 50753925 - 50753955
Alignment:
28 taaaatatggttttggtccctgcaaatatat 58  Q
    |||||||||||||||||||||||||||||||    
50753925 taaaatatggttttggtccctgcaaatatat 50753955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 53717054 - 53717004
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg 199  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| ||||||    
53717054 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg 53717004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 11285606 - 11285675
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || || |||||||||||||||||||  ||||| | |||||||| | |||||||||||    
11285606 aaatagtctctgaccccatttttgtgatgatttgcatacatggcataagatgactggatccattttgtag 11285675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 18135996 - 18135943
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
18135996 cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag 18135943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 19903653 - 19903624
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatat 19903624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 22099541 - 22099574
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
22099541 atggctaaaatatggttttagtccctgcaaatat 22099574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 22204054 - 22204087
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||| ||||||||||||||||||||    
22204054 tggctaaaatatgtttttggtccctgcaaatata 22204087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 24474843 - 24474790
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||| ||| ||||| || |||||||| |||||||||    
24474843 cacttttctgatgatttgcatacgtgacacattataactgaaccaattttgtag 24474790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 27427962 - 27428015
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||  || ||| |||| |||||||||    
27427962 cacttttgtgatgatttgcatacgtggcacaatataactaaaccaattttgtag 27428015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 28197160 - 28197111
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||| |||||||||| | | ||| |||||||||||||||||||||||    
28197160 cacttttatgatgatttgtacacgtgacacatgatgactgaacccatttt 28197111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 28449104 - 28449059
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||  ||||| ||||||||||||| |||||    
28449104 ttttgtgatgatttgcatacatggcatatgatgactgaactcattt 28449059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 34361793 - 34361834
Alignment:
15 ataacttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| |||| ||||||||||||||||| ||||||||||||||    
34361793 ataaattcaaggctaaaatatggttttagtccctgcaaatat 34361834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 38054664 - 38054717
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||| | |||||||||    
38054664 cacttttgtgatgatttgcatacgtgacacattataactgaatcaattttgtag 38054717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 42359406 - 42359373
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||| ||||||||||||||||||||    
42359406 tggctaaaatatgtttttggtccctgcaaatata 42359373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 49123204 - 49123151
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
49123204 cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag 49123151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 50714567 - 50714534
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
50714567 atggctaaaatatggttttagtccctgcaaatat 50714534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 53717176 - 53717143
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
53717176 atggctaaaatatggttttagtccctgcaaatat 53717143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 244
Target Start/End: Complemental strand, 54121680 - 54121647
Alignment:
211 tccttgcaaaatattttattttttaaaatagttc 244  Q
    ||||||||||||||||| ||||||||||||||||    
54121680 tccttgcaaaatattttgttttttaaaatagttc 54121647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 55072509 - 55072558
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||| ||||||||||||| ||||||||| || |||||||| |||||    
55072509 cacttttgcgatgatttgcatacgtggcacattataactgaaccaatttt 55072558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 5202929 - 5202957
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
5202929 taaaatatggttttggtccctgcaaatat 5202957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 8191392 - 8191360
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
8191392 tggctaaaatatggttttagtccctgcaaatat 8191360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 8905235 - 8905203
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||| ||||||    
8905235 tggctaaaatatggttttggtccctgtaaatat 8905203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 9836943 - 9836991
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||| |||||||||||| |||||||||    
9836943 cacttttatgatgatttgcacacgtgtcacatgatgactaaacccattt 9836991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 12152373 - 12152325
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||   |||||||| ||||||||||| |||||    
12152373 cacttttgtgatgatttgcactcgtggcacacgatgactgaactcattt 12152325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 13064276 - 13064328
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 201  Q
    |||||||||||||||||||||| ||||||||| || ||  |||| ||||||||    
13064276 cacttttgtgatgatttgcatacgtggcacattataacaaaaccaattttgta 13064328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 14791502 - 14791530
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
14791502 taaaatatggttttggtccctgcaaatat 14791530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 20144423 - 20144451
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
20144423 taaaatatggttttggtccctgcaaatat 20144451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26313987 - 26314019
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| |||||||||||||    
26313987 tggctaaaatatggttttgatccctgcaaatat 26314019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 26314110 - 26314158
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| || ||  | |||||||||||||||||||    
26314110 cacttttgtgatgatttgcacatctgcaatatgatgactgaacccattt 26314158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 29499543 - 29499515
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
29499543 taaaatatggttttggtccctgcaaatat 29499515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 30060772 - 30060800
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
30060772 taaaatatggttttggtccctgcaaatat 30060800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35415634 - 35415602
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
35415634 tggctaaaatatggttttagtccctgcaaatat 35415602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 36054155 - 36054119
Alignment:
20 ttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| |||||||||| |||||||||||||||||||||    
36054155 ttcaaggctaaaatacggttttggtccctgcaaatat 36054119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Original strand, 41324769 - 41324797
Alignment:
25 ggctaaaatatggttttggtccctgcaaa 53  Q
    |||||||||||||||||||||||||||||    
41324769 ggctaaaatatggttttggtccctgcaaa 41324797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 42358032 - 42358064
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
42358032 ggctaaaatatgtttttggtccctgcaaatata 42358064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 50714239 - 50714271
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
50714239 tggctaaaatatggttttagtccctgcaaatat 50714271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 51545629 - 51545661
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||| |||||||||||||||    
51545629 ggctaaaatatggttttagtccctgcaaatata 51545661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 52543609 - 52543561
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||| ||||||||||||||| ||||||    
52543609 cacttttctgatgatttgcacacgtgtcacatgatgactgaatccattt 52543561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 54208822 - 54208794
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
54208822 taaaatatggttttggtccctgcaaatat 54208794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 176)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 11822125 - 11822210
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||        ||||||||||||||||| ||||||||||    
11822125 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag-tttttgatccttgcaaaatattttgttttttaaaa 11822210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 138 - 202
Target Start/End: Original strand, 18079508 - 18079572
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||| ||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||    
18079508 gtctctggccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattttgtag 18079572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 22919804 - 22919854
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
22919804 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 22919854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 26191480 - 26191530
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
26191480 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 26191530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 16083155 - 16083224
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| || ||| || ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
16083155 aaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 16083224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 33067608 - 33067559
Alignment:
153 tttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||    
33067608 tttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 33067559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 34808316 - 34808401
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| ||||||||| |||||||||||||||||||||        ||| ||||||||||||||||||||||||    
34808316 ttttgtgatgatttgcatacgtggcacataatgactgaacccattttgtag-tttttggtccctgcaaaatattttattttttaaaa 34808401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 48609492 - 48609423
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || || ||||||||||||||||||| |||||||||||||||| ||||||||||||||    
48609492 aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaacccattttgtag 48609423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 1811149 - 1811099
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||    
1811149 ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag 1811099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 13770611 - 13770661
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||||||    
13770611 ttttgtgatgatttgcatacgtggcacatgacgactgaacccattttgtag 13770661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 18900013 - 18899963
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
18900013 ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 18899963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 20756141 - 20756191
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||    
20756141 ttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtag 20756191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 136 - 198
Target Start/End: Original strand, 22674310 - 22674372
Alignment:
136 tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||| ||| ||||||||||||||||| ||  ||||||||||||||||||||||||||||    
22674310 tagtctctggccccacttttgtgatgatttacagttgtggcacatgatgactgaacccatttt 22674372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 39303874 - 39303824
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||| |||||||||||    
39303874 ttttgtgatgatttgcatacgtggcacatgatgactgaatccattttgtag 39303824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 46868349 - 46868399
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||    
46868349 ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag 46868399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 24649453 - 24649522
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
24649453 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 24649522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 48955962 - 48955893
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
48955962 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 48955893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10887353 - 10887401
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
10887353 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 10887401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16060715 - 16060763
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
16060715 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 16060763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24510062 - 24510110
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||    
24510062 cacttttgtgatgatttgcagatgtggcacatgatgactgaacctattt 24510110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24977899 - 24977947
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
24977899 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 24977947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 33234667 - 33234715
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |||||||||||||||| |||||||||||    
33234667 cacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt 33234715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 27521691 - 27521748
Alignment:
147 ctcacttttgtgatgatttgcatatgtggcacatgatgac--tgaacccattttgtag 202  Q
    |||| ||||||||||||||||||| |||||||||||||||  ||||||||||||||||    
27521691 ctcatttttgtgatgatttgcatacgtggcacatgatgacagtgaacccattttgtag 27521748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 33380009 - 33380059
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||| ||||| |||||||||    
33380009 ttttgtgatgatttgcatacgtggcacatgatgaccgaaccaattttgtag 33380059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 37545830 - 37545780
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||| ||||||||| ||| |||||||||||||||||||||||||||    
37545830 ttttgtgataatttgcatacgtgccacatgatgactgaacccattttgtag 37545780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 149 - 239
Target Start/End: Complemental strand, 48730498 - 48730408
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaat 239  Q
    |||||||||||||||||||| | ||| ||||||||||||||||| |||||||||        |||  ||||||||||||| ||||||||||    
48730498 cacttttgtgatgatttgcacacgtgacacatgatgactgaacctattttgtagaaaaatagtcccagcaaaatattttaatttttaaaat 48730408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 2733287 - 2733356
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
2733287 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 2733356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 12361130 - 12361183
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
12361130 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 12361183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 18302280 - 18302211
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  |  |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
18302280 aaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 18302211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 18473391 - 18473444
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
18473391 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 18473444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 21383221 - 21383274
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||||||||||||| || |||||||| |||||||||    
21383221 cacttttgtgattatttgcatatgtggcacattataactgaaccaattttgtag 21383274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 26442781 - 26442728
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||| ||||| || |||||||| |||||||||    
26442781 cacttttgtgatgatttgcatatgtgacacattataactgaaccaattttgtag 26442728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 32728930 - 32728877
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
32728930 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 32728877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 41358544 - 41358491
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
41358544 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 41358491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 41881213 - 41881266
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||||| || ||| |||| |||||||||    
41881213 cacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtag 41881266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 45290560 - 45290629
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
45290560 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 45290629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 45368729 - 45368645
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||||||| |||| |||||||||||  |||||||||        ||||||||||||||||| ||||||||||    
45368729 ttttgtgatgatttgcatatgtgtcacacgatgactgaactgattttgtag--tttttatccttgcaaaatattttgttttttaaaa 45368645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 46183812 - 46183857
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||    
46183812 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 46183857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 193
Target Start/End: Original strand, 5058845 - 5058889
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaaccc 193  Q
    ||||||| |||||||||||| ||||||||||||||||||||||||    
5058845 cacttttatgatgatttgcacatgtggcacatgatgactgaaccc 5058889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 12360723 - 12360771
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||||||||| |||| |||||||||||    
12360723 cacttttgtgatgatttgcacatgtggcacataatgagtgaacccattt 12360771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 15466252 - 15466300
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||| ||||||||||||    
15466252 cacttttgtgatgatttgcacacgtggcacatgatgtctgaacccattt 15466300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 238
Target Start/End: Complemental strand, 16097703 - 16097615
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    |||||||||||||||| |||| ||| |||||||||||||| | ||||||||||        ||||||||||||||||| | ||||||||    
16097703 acttttgtgatgatttccatacgtgacacatgatgactgatctcattttgtagaaaagaagtccttgcaaaatattttgtgttttaaaa 16097615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 17129964 - 17129916
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||| |||||||||||||||||||    
17129964 cacttttgtgatgatttgcacacgtggcagatgatgactgaacccattt 17129916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25658182 - 25658135
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
25658182 cacttttgtgatgatttgcaca-gtggcacatgatgactgaacccattt 25658135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 33045476 - 33045524
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||| |||||||||||    
33045476 cacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt 33045524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 238
Target Start/End: Original strand, 37624807 - 37624895
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| | ||||||||| |||| |||| |||||||||||        ||| |||||||||||||| |||||||||    
37624807 acttttgtgatgatttgcacacgtggcacatcatgaatgaatccattttgtagagaaatagtccctgcaaaatattttaatttttaaaa 37624895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 39747593 - 39747641
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||| |||||||||    
39747593 cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 39747641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 44157922 - 44157874
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||| |||||||||||    
44157922 cacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt 44157874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 7350627 - 7350569
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| |||||||||||||||||||| | |||||||||||||||| |||||||||    
7350627 gtctctggccccacttttgtgatgatttgca-acgtggcacatgatgactaaacccattt 7350569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 41738905 - 41738964
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| ||||||||| |||||||||| | ||||||||||||||||||||| ||||    
41738905 gtctcttgccccacttttgtaatgatttgcacacgtggcacatgatgactgaacctattt 41738964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 52254310 - 52254353
Alignment:
159 atgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||||||||||||||| |||||||||    
52254310 atgatttgcatacgtggcacatgatgactgaaccgattttgtag 52254353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Original strand, 990206 - 990256
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg 199  Q
    |||||||||||||||||||||| ||||||||| || |||||||| ||||||    
990206 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 990256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 3753332 - 3753378
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||| ||||  |||||||||||||||||||||    
3753332 ttttgtgatgatttgcatacgtggtgcatgatgactgaacccatttt 3753378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 29072620 - 29072705
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||| ||||| |||||||| |||||||| ||||||||||||         ||| ||||||||||||||||||||||||    
29072620 ttttgtgatgattcgcatacgtggcacaagatgactggacccattttgta-atttttggtccctgcaaaatattttattttttaaaa 29072705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 35005507 - 35005557
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||| || |||||||| |||||||||    
35005507 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 35005557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 44641316 - 44641266
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg 199  Q
    |||||||||||||||||||||| ||||||||| || |||||||| ||||||    
44641316 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 44641266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 1159721 - 1159668
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||||||||||| | || |||||||| |||||||||    
1159721 cacttttatgatgatttgcatatgtggcacgttataactgaaccaattttgtag 1159668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 3679743 - 3679796
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
3679743 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 3679796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7001777 - 7001724
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || ||| |||| |||||||||    
7001777 cacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtag 7001724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 10552194 - 10552141
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || ||| |||| |||||||||    
10552194 cacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtag 10552141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 13260105 - 13260158
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
13260105 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 13260158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 17984577 - 17984524
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
17984577 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 17984524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19622775 - 19622828
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
19622775 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 19622828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 21391259 - 21391206
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
21391259 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 21391206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 24510310 - 24510277
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
24510310 atggctaaaatatggttttggtccctgcaaatat 24510277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 26062076 - 26062129
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||| | |||||||||    
26062076 cacttttgtgatgatttgcatacgtggcacattataactgaatcaattttgtag 26062129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 28507238 - 28507283
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| ||||| |||||||||||||||| |||||    
28507238 ttttgtgatgatttgcacatgtgacacatgatgactgaactcattt 28507283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 35056528 - 35056561
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
35056528 atggctaaaatatggttttggtccctgcaaatat 35056561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35307991 - 35307938
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| ||||||||||||| ||||||||| || |||||||| |||||||||    
35307991 cacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtag 35307938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4789428 - 4789476
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||  | | ||||||||||||||||||||||||||    
4789428 cacttttgtgatgatttaaacacgtggcacatgatgactgaacccattt 4789476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 8364856 - 8364808
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| |||||||||||||||| |||||    
8364856 cacttttgtgatgatttgcacacgtgacacatgatgactgaactcattt 8364808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 10631163 - 10631195
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
10631163 tggctaaaatatggttttggtccctgcaaatat 10631195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 12322971 - 12322939
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
12322971 tggctaaaatatggttttggtccctgcaaatat 12322939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 16060886 - 16060854
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
16060886 tggctaaaatatggttttggtccctgcaaatat 16060854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 18927897 - 18927945
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | ||||||||||||||||||||| ||||    
18927897 cacttttgtgatgatttacacacgtggcacatgatgactgaaccaattt 18927945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 19198829 - 19198781
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||| || ||||||||||    
19198829 cacttttgtgatgatttgcacacgtggcacatgataacggaacccattt 19198781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24653801 - 24653833
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
24653801 tggctaaaatatggttttggtccctgcaaatat 24653833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24977777 - 24977809
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
24977777 tggctaaaatatggttttggtccctgcaaatat 24977809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 31060786 - 31060818
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
31060786 tggctaaaatatggttttggtccctgcaaatat 31060818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 32035675 - 32035627
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||| | | ||| ||||||||||||||||||||||    
32035675 cacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt 32035627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 38151213 - 38151181
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
38151213 tggctaaaatatggttttggtccctgcaaatat 38151181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 40718109 - 40718141
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
40718109 tggctaaaatatggttttggtccctgcaaatat 40718141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40718475 - 40718443
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
40718475 tggctaaaatatggttttggtccctgcaaatat 40718443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 41738795 - 41738827
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
41738795 tggctaaaatatggttttggtccctgcaaatat 41738827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 45638579 - 45638611
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
45638579 tggctaaaatatggttttggtccctgcaaatat 45638611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 49923707 - 49923659
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||| |||||||| |||| |||||||||||||||||| ||||    
49923707 cacttttgtgaagatttgcacatgtagcacatgatgactgaacctattt 49923659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 51986456 - 51986408
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||| ||||||    
51986456 cacttttgtgatgatttgcacacgtgacacatgatgactgaatccattt 51986408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3247198 - 3247229
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3247198 ggctaaaatatggttttggtccctgcaaatat 3247229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 7867357 - 7867326
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
7867357 ggctaaaatatggttttggtccctgcaaatat 7867326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 8140434 - 8140465
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
8140434 ggctaaaatatggttttggtccctgcaaatat 8140465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10631528 - 10631497
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
10631528 ggctaaaatatggttttggtccctgcaaatat 10631497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 10887233 - 10887264
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
10887233 ggctaaaatatggttttggtccctgcaaatat 10887264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10887598 - 10887567
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
10887598 ggctaaaatatggttttggtccctgcaaatat 10887567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12360603 - 12360634
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12360603 ggctaaaatatggttttggtccctgcaaatat 12360634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12360968 - 12360937
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12360968 ggctaaaatatggttttggtccctgcaaatat 12360937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 200
Target Start/End: Complemental strand, 15335175 - 15335124
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgt 200  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||    
15335175 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt 15335124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 15516582 - 15516613
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
15516582 ggctaaaatatggttttggtccctgcaaatat 15516613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 15526362 - 15526331
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
15526362 ggctaaaatatggttttggtccctgcaaatat 15526331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 16026818 - 16026775
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
16026818 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 16026775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 16026938 - 16026907
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
16026938 ggctaaaatatggttttggtccctgcaaatat 16026907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 18208802 - 18208849
Alignment:
148 tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccat 195  Q
    ||||||||||||||||||||| | |||||| | |||||||||||||||    
18208802 tcacttttgtgatgatttgcacacgtggcagaggatgactgaacccat 18208849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19720712 - 19720743
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19720712 ggctaaaatatggttttggtccctgcaaatat 19720743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 24507843 - 24507812
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
24507843 ggctaaaatatggttttggtccctgcaaatat 24507812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 24654167 - 24654136
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
24654167 ggctaaaatatggttttggtccctgcaaatat 24654136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 29688313 - 29688270
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||||||||||||| ||||||||| || ||||||||    
29688313 cacttttgtgatgatttgcatacgtggcacattataactgaacc 29688270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 30322929 - 30322960
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
30322929 ggctaaaatatggttttggtccctgcaaatat 30322960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 32035788 - 32035757
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
32035788 ggctaaaatatggttttggtccctgcaaatat 32035757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 33000305 - 33000336
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
33000305 ggctaaaatatggttttggtccctgcaaatat 33000336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 33000549 - 33000506
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
33000549 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 33000506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 33000669 - 33000638
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
33000669 ggctaaaatatggttttggtccctgcaaatat 33000638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 33045690 - 33045659
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
33045690 ggctaaaatatggttttggtccctgcaaatat 33045659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 33234546 - 33234577
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
33234546 ggctaaaatatggttttggtccctgcaaatat 33234577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 36912853 - 36912884
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
36912853 ggctaaaatatggttttggtccctgcaaatat 36912884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 38150968 - 38151011
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
38150968 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 38151011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 38164295 - 38164264
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
38164295 ggctaaaatatggttttggtccctgcaaatat 38164264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 39747835 - 39747804
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
39747835 ggctaaaatatggttttggtccctgcaaatat 39747804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 42482979 - 42483010
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
42482979 ggctaaaatatggttttggtccctgcaaatat 42483010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 42483211 - 42483168
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||||||||||| | ||| |||||||||||||||||    
42483211 cacttttgtgatgatttgcacacgtgtcacatgatgactgaacc 42483168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 42483271 - 42483240
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
42483271 ggctaaaatatggttttggtccctgcaaatat 42483240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 45380272 - 45380303
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
45380272 ggctaaaatatggttttggtccctgcaaatat 45380303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 45638894 - 45638863
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
45638894 ggctaaaatatggttttggtccctgcaaatat 45638863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47819232 - 47819263
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
47819232 ggctaaaatatggttttggtccctgcaaatat 47819263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 47819596 - 47819565
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
47819596 ggctaaaatatggttttggtccctgcaaatat 47819565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 155 - 202
Target Start/End: Original strand, 49226361 - 49226408
Alignment:
155 tgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||| ||||||||| || |||||||| |||||||||    
49226361 tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 49226408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 11711314 - 11711280
Alignment:
23 atggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||| ||||||||||||||||||||    
11711314 atggctaaaatatgtttttggtccctgcaaatata 11711280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Original strand, 15058419 - 15058449
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
15058419 gctaaaatatggttttggtccctgcaaatat 15058449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 23470030 - 23469996
Alignment:
23 atggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||| ||||||||||||||||||||    
23470030 atggctaaaatatgtttttggtccctgcaaatata 23469996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Complemental strand, 37396901 - 37396867
Alignment:
23 atggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||| ||||||||||||||||||||    
37396901 atggctaaaatatgcttttggtccctgcaaatata 37396867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 53
Target Start/End: Complemental strand, 39025383 - 39025353
Alignment:
23 atggctaaaatatggttttggtccctgcaaa 53  Q
    |||||||||||||||||||||||||||||||    
39025383 atggctaaaatatggttttggtccctgcaaa 39025353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Original strand, 44157696 - 44157726
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
44157696 gctaaaatatggttttggtccctgcaaatat 44157726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 4323948 - 4323997
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||| ||| ||||||||| || |||||||| |||||    
4323948 cacttttgtgatgatttgtatacgtggcacattataactgaaccaatttt 4323997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 4789310 - 4789339
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
4789310 ctaaaatatggttttggtccctgcaaatat 4789339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 14007606 - 14007659
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| ||| ||||||||| || |||||| | |||||||||    
14007606 cacttttgtgatgatttgtatacgtggcacattataactgaatcaattttgtag 14007659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 15211860 - 15211827
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||| |||||||||    
15211860 atggctaaaatatggttttggtccttgcaaatat 15211827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 17130081 - 17130052
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
17130081 ctaaaatatggttttggtccctgcaaatat 17130052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 19720954 - 19720913
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaa 190  Q
    |||||||||||| ||||||| | |||||||||||||||||||    
19720954 cacttttgtgataatttgcacacgtggcacatgatgactgaa 19720913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 26191736 - 26191703
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
26191736 atggctaaaatatggttttagtccctgcaaatat 26191703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 31061151 - 31061118
Alignment:
25 ggctaaaatatggttttggtccctgcaaatatat 58  Q
    |||||||||||||||||| |||||||||||||||    
31061151 ggctaaaatatggttttgatccctgcaaatatat 31061118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 31258459 - 31258508
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
31258459 cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 31258508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 32454171 - 32454118
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||| ||| ||||| || |||||||| |||||||||    
32454171 cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag 32454118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 32626774 - 32626721
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||| |||| ||||||||  || |||||||| |||||||||    
32626774 cacttttgtgatgatttacatacgtggcacaatataactgaaccaattttgtag 32626721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 33234914 - 33234881
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||| |||||||||||||||||||    
33234914 atggctaaaatatgattttggtccctgcaaatat 33234881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 34383065 - 34383118
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
34383065 cacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtag 34383118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 242
Target Start/End: Original strand, 39025169 - 39025262
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt 242  Q
    ||||||||||||||||||||   ||| ||||||||||| ||||||||||  |||        ||| |||||||||||||| |||| ||||||||    
39025169 cacttttgtgatgatttgcactcgtgacacatgatgaccgaacccatttattagaaaaatagtccctgcaaaatattttacttttgaaaatagt 39025262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 46183686 - 46183715
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
46183686 ctaaaatatggttttggtccctgcaaatat 46183715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 3247559 - 3247531
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
3247559 taaaatatggttttggtccctgcaaatat 3247531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 7001898 - 7001866
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
7001898 tggctaaaatatggttttagtccctgcaaatat 7001866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 7818978 - 7818934
Alignment:
154 ttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||| ||||||||| || |||||||| |||||    
7818978 ttgtgatgatttgcatacgtggcacattataactgaaccaatttt 7818934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 9774947 - 9774915
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
9774947 ggctaaaatatgcttttggtccctgcaaatata 9774915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 12322603 - 12322635
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| |||||||||||||    
12322603 tggctaaaatatggttttgatccctgcaaatat 12322635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 12322725 - 12322773
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| |||||||||||||| | |||||| ||||    
12322725 cacttttatgatgatttgcacatgtggcacatgataattgaaccaattt 12322773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 17977618 - 17977586
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||| ||||||||||||||||||||||||||||    
17977618 ggcttaaatatggttttggtccctgcaaatata 17977586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 20723747 - 20723715
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
20723747 ggctaaaatatgtttttggtccctgcaaatata 20723715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 20948754 - 20948786
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||| |||||||    
20948754 tggctaaaatatggttttggtccctacaaatat 20948786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 22953557 - 22953525
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
22953557 tggctaaaatatggttttagtccctgcaaatat 22953525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24507478 - 24507510
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| |||||||||||||    
24507478 tggctaaaatatggttttgatccctgcaaatat 24507510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24649349 - 24649381
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
24649349 tggctaaaatatggttttagtccctgcaaatat 24649381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 25658013 - 25658045
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||| ||||||||    
25658013 tggctaaaatatggttttggtccccgcaaatat 25658045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26191358 - 26191390
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
26191358 tggctaaaatatggttttagtccctgcaaatat 26191390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 27262908 - 27262940
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
27262908 ggctaaaatatgtttttggtccctgcaaatata 27262940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 27264275 - 27264243
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
27264275 ggctaaaatatgattttggtccctgcaaatata 27264243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 29072863 - 29072831
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
29072863 tggctaaaatatggttttagtccctgcaaatat 29072831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 34002695 - 34002735
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactga 189  Q
    ||||||||||| |||||||| | ||||||||||||||||||    
34002695 cacttttgtgacgatttgcacacgtggcacatgatgactga 34002735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 35307710 - 35307746
Alignment:
20 ttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| ||||||||||||||||| ||||||||||||||    
35307710 ttcaaggctaaaatatggttttagtccctgcaaatat 35307746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35308112 - 35308080
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
35308112 tggctaaaatatggttttagtccctgcaaatat 35308080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 35721101 - 35721133
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
35721101 ggctaaaatatgtttttggtccctgcaaatata 35721133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 35911947 - 35911915
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
35911947 ggctaaaatatgcttttggtccctgcaaatata 35911915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 37395633 - 37395665
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
37395633 ggctaaaatatgtttttggtccctgcaaatata 37395665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 38136982 - 38136950
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
38136982 tggctaaaatatgattttggtccctgcaaatat 38136950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 38150851 - 38150879
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
38150851 taaaatatggttttggtccctgcaaatat 38150879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 38163934 - 38163962
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
38163934 taaaatatggttttggtccctgcaaatat 38163962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 39025112 - 39025140
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
39025112 taaaatatggttttggtccctgcaaatat 39025140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 45380637 - 45380605
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
45380637 tggctaaaatatgattttggtccctgcaaatat 45380605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 45979555 - 45979523
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
45979555 ggctaaaatatgtttttggtccctgcaaatata 45979523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 48956067 - 48956035
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
48956067 tggctaaaatatggttttagtccctgcaaatat 48956035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 52254480 - 52254448
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
52254480 tggctaaaatatggttttagtccctgcaaatat 52254448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 94180 - 94230
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
94180 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 94230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 345956 - 345924
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
345956 ggctaaaatatgtttttggtccctgcaaatata 345924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 376428 - 376396
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
376428 ggctaaaatatgcttttggtccctgcaaatata 376396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 146)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 19757872 - 19757922
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
19757872 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 19757922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 24954048 - 24953979
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||| |  |||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||    
24954048 aaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacctattttgtag 24953979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 145 - 202
Target Start/End: Complemental strand, 38186646 - 38186589
Alignment:
145 gcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||    
38186646 gcctcacttttgtgatgatttgcacacgtgacacatgatgactgaacccattttgtag 38186589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 41054056 - 41054008
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||    
41054056 cacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt 41054008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 238
Target Start/End: Original strand, 45671328 - 45671419
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||| ||||||||||||||||||| ||| |||||||||||||||| ||||||||||        |||||| |||||||||||||||||||||    
45671328 cctcatttttgtgatgatttgcatacgtgacacatgatgactgaactcattttgtag-ttttttgtccttgtaaaatattttattttttaaaa 45671419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 10358125 - 10358175
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
10358125 ttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtag 10358175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 13769893 - 13769943
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
13769893 ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag 13769943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 19465740 - 19465790
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
19465740 ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 19465790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 239
Target Start/End: Original strand, 20388396 - 20388482
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaat 239  Q
    ||||||||||||||||||| |||||| |||||||||||||| |||||||||        ||||||||||||||||| |||||||||||    
20388396 ttttgtgatgatttgcatacgtggcatatgatgactgaaccgattttgtag-tttttggtccttgcaaaatattttgttttttaaaat 20388482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 32189273 - 32189223
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||| ||||||||||||| ||||||||||||||||    
32189273 ttttgtgatgatttgcatatatggcacatgatgattgaacccattttgtag 32189223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 41365094 - 41365044
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||    
41365094 ttttgtgatgatttgcatacatggcacatgatgactgaacccattttgtag 41365044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 46648535 - 46648585
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||| || |||||||||||||||||||||||||||||||    
46648535 ttttgtgatgatttgcgtacgtggcacatgatgactgaacccattttgtag 46648585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19561267 - 19561320
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||||| || |||||||| |||||||||    
19561267 cacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag 19561320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 21223510 - 21223579
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
21223510 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 21223579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 45073539 - 45073470
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
45073539 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 45073470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 46304279 - 46304210
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
46304279 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 46304210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 48358974 - 48358905
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
48358974 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 48358905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5354998 - 5354950
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
5354998 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 5354950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 9659475 - 9659523
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
9659475 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 9659523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 11767037 - 11767085
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
11767037 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 11767085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 133 - 201
Target Start/End: Original strand, 14738702 - 14738770
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 201  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| ||||||||    
14738702 aaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgta 14738770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 30223581 - 30223629
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
30223581 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 30223629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 39520518 - 39520566
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
39520518 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 39520566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 48852564 - 48852612
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||    
48852564 cacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt 48852612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 35470159 - 35470112
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||| | ||||||||||||||||||||||||||    
35470159 acttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35470112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 31310557 - 31310507
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||| ||||||||| |||||||||||    
31310557 ttttgtgatgatttgcatacgtggcacattatgactgaatccattttgtag 31310507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 488816 - 488885
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
488816 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 488885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 1007110 - 1007057
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
1007110 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 1007057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 3808072 - 3808011
Alignment:
136 tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||  ||||||||||||||||||||||| | ||| ||||||||||| ||||||||||    
3808072 tagtctctgacctcacttttgtgatgatttgcacacgtgacacatgatgaccgaacccattt 3808011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 5308584 - 5308515
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
5308584 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 5308515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6108578 - 6108525
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
6108578 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 6108525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 7432071 - 7432124
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
7432071 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 7432124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 12894283 - 12894230
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
12894283 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 12894230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 18311683 - 18311752
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || | |||||| |||||||||    
18311683 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtag 18311752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 145 - 242
Target Start/End: Complemental strand, 19005822 - 19005725
Alignment:
145 gcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt 242  Q
    ||||||||| |||||||||||||| ||||| |||||||||| |||||||||||  |||        ||| |||||||||||||| |||| ||||||||    
19005822 gcctcacttctgtgatgatttgcacatgtgacacatgatgattgaacccatttattagtaaataggtccctgcaaaatattttacttttgaaaatagt 19005725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19783934 - 19783987
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
19783934 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 19783987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 21554634 - 21554581
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||| |||||||||||||||||| || |||||||| |||||||||    
21554634 cacttttgtgatgttttgcatatgtggcacattataactgaaccaattttgtag 21554581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 23816932 - 23816863
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || || ||||||||||||||| ||| |||||||||||||||| |||| |||||||||    
23816932 aaatagtctctgaccccatttttgtgatgatttgtatacgtggcacatgatgactaaaccgattttgtag 23816863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 28911697 - 28911750
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||||||||||||||||||    
28911697 cacttttgtgatgatttgcatacgtgacacattataactgaacccattttgtag 28911750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35015100 - 35015047
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
35015100 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 35015047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 39719473 - 39719526
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
39719473 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 39719526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 44403149 - 44403080
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||| | || |||||||| |||||||||    
44403149 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaattttgtag 44403080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 45021615 - 45021668
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
45021615 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 45021668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 45228707 - 45228752
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||    
45228707 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 45228752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 242
Target Start/End: Complemental strand, 46759853 - 46759760
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt 242  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||  |||        ||| ||||||||||||| ||||| ||||||||    
46759853 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgtttttgaaaatagt 46759760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 6589081 - 6589129
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||    
6589081 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 6589129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16940882 - 16940930
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
16940882 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 16940930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 27458519 - 27458567
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||    
27458519 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 27458567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35104138 - 35104186
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||| ||||||||||||    
35104138 cacttttgtgatgatttgcacacgtggcacatgatggctgaacccattt 35104186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35665995 - 35666043
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||||| ||| |||||||||||||||| |||||    
35665995 cacttttgtgatgatttgcatacgtgacacatgatgactgaactcattt 35666043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35838044 - 35838092
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||| ||||||||    
35838044 cacttttgtgatgatttgcacacgtggcacatgatgactggacccattt 35838092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 38486673 - 38486625
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
38486673 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 38486625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 39438909 - 39438861
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||| |||||||||||| |||||||||    
39438909 cacttttgtgatgatttgcacatgtgacacatgatgactaaacccattt 39438861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 44841475 - 44841523
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||| | | ||||||||||||||||||||||||||    
44841475 cacttttgtgatgatttggacacgtggcacatgatgactgaacccattt 44841523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 1271490 - 1271431
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| |||||||||||| ||||| | | ||||||||||||||||||||||||||    
1271490 gtctctagccccacttttgtgataatttgtacacgtggcacatgatgactgaacccattt 1271431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 27037582 - 27037624
Alignment:
14 aataacttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||| || ||||||||||||||||||||||||||||||||||    
27037582 aataattttatggctaaaatatggttttggtccctgcaaatat 27037624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 30352683 - 30352733
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||| || |||||||| |||||||||    
30352683 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 30352733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 31732329 - 31732279
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||| || |||||||| |||||||||    
31732329 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 31732279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 43300730 - 43300780
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||| |||||||||||| ||||||||||||||||||||| ||| |||||    
43300730 ttttgtaatgatttgcatacgtggcacatgatgactgaacctattgtgtag 43300780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 18022485 - 18022538
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||| ||||||||| || |||||||| |||||||||    
18022485 cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag 18022538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 29198303 - 29198336
Alignment:
25 ggctaaaatatggttttggtccctgcaaatatat 58  Q
    ||||||||||||||||||||||||||||||||||    
29198303 ggctaaaatatggttttggtccctgcaaatatat 29198336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 34877893 - 34877942
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||| | | |||||||||||| ||||||||||||    
34877893 cacttttgtgatgatttgcacacgcggcacatgatgattgaacccatttt 34877942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 44508822 - 44508891
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || ||||||||| |||||||||||| ||||||||| || | |||||| |||||||||    
44508822 aaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaattttgtag 44508891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 2945725 - 2945677
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||| |||| |||||    
2945725 cacttttgtgatgatttgcacacgtggcacatgatgaccgaactcattt 2945677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 3975719 - 3975671
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||| |||||||||| | |||||||||||||||||||| |||||    
3975719 cacttttgtaatgatttgcacacgtggcacatgatgactgaactcattt 3975671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 6589020 - 6589052
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
6589020 tggctaaaatatggttttggtccctgcaaatat 6589052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 6892014 - 6892062
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||| | |||||||||||||||||    
6892014 cacttttgtgatgatttgcacaggtggcagaagatgactgaacccattt 6892062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 16853590 - 16853558
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
16853590 tggctaaaatatggttttggtccctgcaaatat 16853558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 22540173 - 22540125
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| || ||||||||||||| ||||| |||||    
22540173 cacttttgtgatgatttgcacatttggcacatgatgattgaactcattt 22540125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 31503663 - 31503615
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||| ||||| | | ||||||||||||||||||||||||||    
31503663 cacttttgtgataatttgtacacgtggcacatgatgactgaacccattt 31503615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 44568326 - 44568358
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||    
44568326 ggctaaaatatggttttggtccctgcaaatata 44568358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1614559 - 1614590
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1614559 ggctaaaatatggttttggtccctgcaaatat 1614590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1614904 - 1614873
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1614904 ggctaaaatatggttttggtccctgcaaatat 1614873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3975549 - 3975580
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3975549 ggctaaaatatggttttggtccctgcaaatat 3975580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3975838 - 3975807
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3975838 ggctaaaatatggttttggtccctgcaaatat 3975807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 5233808 - 5233839
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
5233808 ggctaaaatatggttttggtccctgcaaatat 5233839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 8144295 - 8144326
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
8144295 ggctaaaatatggttttggtccctgcaaatat 8144326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 8144658 - 8144627
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
8144658 ggctaaaatatggttttggtccctgcaaatat 8144627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 9659689 - 9659658
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
9659689 ggctaaaatatggttttggtccctgcaaatat 9659658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 11767275 - 11767244
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
11767275 ggctaaaatatggttttggtccctgcaaatat 11767244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14543710 - 14543741
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14543710 ggctaaaatatggttttggtccctgcaaatat 14543741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 14543799 - 14543846
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||| | ||| ||||||||||||||| ||||||    
14543799 acttttgtgatgatttgcacacgtgacacatgatgactgaatccattt 14543846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 23399612 - 23399643
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
23399612 ggctaaaatatggttttggtccctgcaaatat 23399643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 23399976 - 23399945
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
23399976 ggctaaaatatggttttggtccctgcaaatat 23399945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 23676452 - 23676421
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
23676452 ggctaaaatatggttttggtccctgcaaatat 23676421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25092160 - 25092191
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25092160 ggctaaaatatggttttggtccctgcaaatat 25092191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25092548 - 25092517
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25092548 ggctaaaatatggttttggtccctgcaaatat 25092517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25988385 - 25988416
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25988385 ggctaaaatatggttttggtccctgcaaatat 25988416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25988749 - 25988718
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25988749 ggctaaaatatggttttggtccctgcaaatat 25988718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 26878071 - 26878040
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
26878071 ggctaaaatatggttttggtccctgcaaatat 26878040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 27458399 - 27458430
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
27458399 ggctaaaatatggttttggtccctgcaaatat 27458430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28262713 - 28262744
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
28262713 ggctaaaatatggttttggtccctgcaaatat 28262744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29198662 - 29198631
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
29198662 ggctaaaatatggttttggtccctgcaaatat 29198631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 30709443 - 30709494
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgt 200  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||    
30709443 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt 30709494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 56
Target Start/End: Original strand, 35469876 - 35469911
Alignment:
21 tcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||| |||||||||||||    
35469876 tcatggctaaaatatggttttgatccctgcaaatat 35469911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35837924 - 35837955
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35837924 ggctaaaatatggttttggtccctgcaaatat 35837955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 35838337 - 35838306
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35838337 ggctaaaatatggttttggtccctgcaaatat 35838306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 41053842 - 41053873
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
41053842 ggctaaaatatggttttggtccctgcaaatat 41053873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 41054236 - 41054205
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
41054236 ggctaaaatatggttttggtccctgcaaatat 41054205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 45228918 - 45228887
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
45228918 ggctaaaatatggttttggtccctgcaaatat 45228887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 46759658 - 46759689
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
46759658 ggctaaaatatggttttggtccctgcaaatat 46759689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 46828944 - 46828975
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
46828944 ggctaaaatatggttttggtccctgcaaatat 46828975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 48192488 - 48192457
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
48192488 ggctaaaatatggttttggtccctgcaaatat 48192457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 48852444 - 48852475
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
48852444 ggctaaaatatggttttggtccctgcaaatat 48852475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 55
Target Start/End: Complemental strand, 39439029 - 39438999
Alignment:
25 ggctaaaatatggttttggtccctgcaaata 55  Q
    |||||||||||||||||||||||||||||||    
39439029 ggctaaaatatggttttggtccctgcaaata 39438999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 1559587 - 1559538
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
1559587 cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 1559538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 1974007 - 1974040
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
1974007 atggctaaaatatggttttagtccctgcaaatat 1974040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 6847117 - 6847088
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
6847117 ctaaaatatggttttggtccctgcaaatat 6847088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 6911248 - 6911215
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||||||| ||||||||||||    
6911248 tggctaaaatatggttttggttcctgcaaatata 6911215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 29 - 58
Target Start/End: Original strand, 6954862 - 6954891
Alignment:
29 aaaatatggttttggtccctgcaaatatat 58  Q
    ||||||||||||||||||||||||||||||    
6954862 aaaatatggttttggtccctgcaaatatat 6954891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 19561152 - 19561185
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
19561152 atggctaaaatatggttttagtccctgcaaatat 19561185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35210393 - 35210340
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||| |||||| ||||||||| || |||||| | |||||||||    
35210393 cacttttgtgatgatgtgcatacgtggcacattataactgaatcaattttgtag 35210340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 37372786 - 37372733
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| |||  |||| || |||||||| |||||||||    
37372786 cacttttgtgatgatttgcatacgtgatacattataactgaaccaattttgtag 37372733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 37952933 - 37952884
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||| ||||||||| || ||||||||||| |||| |||||||    
37952933 cacttttgtgattatttgcatacgtagcacatgatgattgaatccatttt 37952884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 44344672 - 44344623
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||| |||| ||||||||| || |||||||| |||||    
44344672 cacttttgtgatgattttcatacgtggcacattataactgaaccaatttt 44344623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 45021492 - 45021525
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
45021492 atggctaaaatatggttttagtccctgcaaatat 45021525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 46829314 - 46829281
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||| |||||||||||||    
46829314 atggctaaaatatggttttgatccctgcaaatat 46829281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 1006834 - 1006866
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
1006834 tggctaaaatatggttttagtccctgcaaatat 1006866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 5611566 - 5611534
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
5611566 ggctaaaatatgattttggtccctgcaaatata 5611534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 6589271 - 6589243
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
6589271 taaaatatggttttggtccctgcaaatat 6589243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 6847000 - 6846952
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||  | |||||||||||||| |||| ||||||    
6847000 cacttttgtgatgatttgcgcacgtggcacatgatgattgaatccattt 6846952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Complemental strand, 6892260 - 6892232
Alignment:
25 ggctaaaatatggttttggtccctgcaaa 53  Q
    |||||||||||||||||||||||||||||    
6892260 ggctaaaatatggttttggtccctgcaaa 6892232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 7431950 - 7431982
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
7431950 tggctaaaatatggttttagtccctgcaaatat 7431982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 11766920 - 11766948
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
11766920 taaaatatggttttggtccctgcaaatat 11766948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 12933419 - 12933451
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
12933419 ggctaaaatatgcttttggtccctgcaaatata 12933451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 13769773 - 13769805
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
13769773 tggctaaaatatggttttagtccctgcaaatat 13769805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 16941049 - 16941021
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
16941049 taaaatatggttttggtccctgcaaatat 16941021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 20355533 - 20355589
Alignment:
147 ctcacttttgtgatgatttgcatatgtggcacatgatgactgaaccc-attttgtag 202  Q
    |||||||||||||||||||| | | ||| |||||||||| ||||||| |||||||||    
20355533 ctcacttttgtgatgatttgtacacgtgacacatgatgattgaacccaattttgtag 20355589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 21223748 - 21223716
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||| |||||||||||||||    
21223748 ggctaaaatatggttttagtccctgcaaatata 21223716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 23676135 - 23676163
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
23676135 taaaatatggttttggtccctgcaaatat 23676163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 24195607 - 24195639
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
24195607 ggctaaaatatgtttttggtccctgcaaatata 24195639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 24197162 - 24197130
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
24197162 ggctaaaatatgcttttggtccctgcaaatata 24197130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24717288 - 24717336
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||| |||||||||| |  || ||||||||||||||||||||||    
24717288 cacttttgtaatgatttgcacacatgacacatgatgactgaacccattt 24717336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 25547491 - 25547459
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
25547491 tggctaaaatatggttttagtccctgcaaatat 25547459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Complemental strand, 27037902 - 27037874
Alignment:
25 ggctaaaatatggttttggtccctgcaaa 53  Q
    |||||||||||||||||||||||||||||    
27037902 ggctaaaatatggttttggtccctgcaaa 27037874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 28262958 - 28262910
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||| |||||||||| |||||    
28262958 cacttttgtgatgatttgcacacgtgacacataatgactgaactcattt 28262910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 28529149 - 28529101
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||| ||||||||| ||||||    
28529149 cacttttgtgatgatttgcacacgtgacacataatgactgaatccattt 28529101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 31732100 - 31732132
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
31732100 tggctaaaatatggttttagtccctgcaaatat 31732132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 32197968 - 32197936
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
32197968 ggctaaaatatgcttttggtccctgcaaatata 32197936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 36748197 - 36748229
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
36748197 tggctaaaatatgtttttggtccctgcaaatat 36748229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 37527302 - 37527254
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||| |||||| |||||    
37527302 cacttttgtgatgatttgcacacgtgacacatgatgcctgaactcattt 37527254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 38186369 - 38186397
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
38186369 taaaatatggttttggtccctgcaaatat 38186397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 44508719 - 44508751
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
44508719 tggctaaaatatggttttagtccctgcaaatat 44508751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 44841711 - 44841683
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
44841711 taaaatatggttttggtccctgcaaatat 44841683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 48192260 - 48192288
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
48192260 taaaatatggttttggtccctgcaaatat 48192288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 48359076 - 48359044
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
48359076 tggctaaaatatggttttagtccctgcaaatat 48359044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 47; Significance: 7e-18; HSPs: 133)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 3850505 - 3850455
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
3850505 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 3850455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 13990728 - 13990813
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| |||||||||||||||| ||||||||||||||        ||| ||||||||||||||||||||||||    
13990728 ttttgtgatgatttgcatacgtggcacatgatgactcaacccattttgtag-tttttagtccctgcaaaatattttattttttaaaa 13990813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 3850699 - 3850652
Alignment:
155 tgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||    
3850699 tgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 3850652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 10743933 - 10743883
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||||| ||||||||||||||||| |||||||||    
10743933 ttttgtgatgatttgcatatgtgtcacatgatgactgaaccgattttgtag 10743883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 14318279 - 14318229
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||    
14318279 ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag 14318229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 34125427 - 34125477
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||||||    
34125427 ttttttgatgatttgcatacgtggcacatgatgactgaacccattttgtag 34125477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7075842 - 7075789
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||||||||||||| || |||||||| |||||||||    
7075842 cacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag 7075789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 215 - 256
Target Start/End: Complemental strand, 15141092 - 15141051
Alignment:
215 tgcaaaatattttattttttaaaatagttcatggccccgctt 256  Q
    ||||||||||||||||||||||||||||||||||||||||||    
15141092 tgcaaaatattttattttttaaaatagttcatggccccgctt 15141051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 238
Target Start/End: Original strand, 17070655 - 17070744
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    |||||||||||||||||||| | |||||||||||||| |||| |||||||||||        |||||||||||||||||  |||||||||    
17070655 cacttttgtgatgatttgcacacgtggcacatgatgaatgaatccattttgtagaaaaatagtccttgcaaaatattttgatttttaaaa 17070744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 35167062 - 35166993
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
35167062 aaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 35166993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 5103890 - 5103842
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||    
5103890 cacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt 5103842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 146 - 202
Target Start/End: Original strand, 21050690 - 21050746
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
21050690 cctcacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 21050746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 32108927 - 32108975
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
32108927 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 32108975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 28213482 - 28213541
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| |||||||||||||||||||| | ||| ||||||||||||||||||||||    
28213482 gtctctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 28213541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 28863712 - 28863662
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| ||||||||||||||||| |||||||||    
28863712 ttttgtgatgatttgcatacgtgtcacatgatgactgaaccgattttgtag 28863662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 5614410 - 5614357
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
5614410 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5614357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6118375 - 6118322
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
6118375 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 6118322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 15635495 - 15635548
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
15635495 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 15635548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 16616481 - 16616534
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
16616481 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 16616534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 18633841 - 18633788
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
18633841 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 18633788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 26071397 - 26071458
Alignment:
136 tagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||  || |||||||||||||||||||| | || |||||||||||||||||||||||    
26071397 tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt 26071458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 30888280 - 30888333
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||||| |||||||| || |||||||| |||||||||    
30888280 cacttttgtgatgatttgcatatatggcacattataactgaaccaattttgtag 30888333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 31602267 - 31602320
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||| | |||||||||||| | ||||||||||||||||    
31602267 cacttttgtgatgatttgcacacgtggcacatgataattgaacccattttgtag 31602320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 35166040 - 35165987
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
35166040 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 35165987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 36577839 - 36577892
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
36577839 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 36577892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 2636789 - 2636837
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||| |||||||||    
2636789 cacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 2636837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 4736422 - 4736374
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||| |||| | ||||||||||||||||||||||||||    
4736422 cacttttgtgatgatctgcacacgtggcacatgatgactgaacccattt 4736374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 9588492 - 9588444
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||| |||| |||| ||||||||||||||||||||||||||    
9588492 cacttttgtgataatttacatacgtggcacatgatgactgaacccattt 9588444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 28107919 - 28107967
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
28107919 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 28107967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 32888800 - 32888848
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | ||||||||||||||||||||||||||    
32888800 cacttttgtgatgatttacacacgtggcacatgatgactgaacccattt 32888848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 35609393 - 35609441
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||    
35609393 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 35609441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 40038615 - 40038663
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||| ||||    
40038615 cacttttgtgatgatttgcacacgtggcacatgatgactgaacctattt 40038663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 5904256 - 5904205
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||||||| ||| || ||||| |||||||||||||    
5904256 cctcacttttgtgatgatttgcatacgtgacatatgataactgaacccattt 5904205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 29855724 - 29855775
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||||| | | ||||||||| ||||||||||||||    
29855724 cctcacttttgtgatgatttgcacacgcggcacatgacgactgaacccattt 29855775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 9532312 - 9532362
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| ||||||| ||| |||||||||||||||    
9532312 ttttgtgatgatttgcatacgtgacacatgacgaccgaacccattttgtag 9532362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 18286531 - 18286589
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaac 191  Q
    ||||||||||| ||| || |||||||||||||| |||| |||||| |||||||||||||    
18286531 aaatagtctctggccccagttttgtgatgatttacatacgtggcatatgatgactgaac 18286589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 45136 - 45169
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
45136 atggctaaaatatggttttggtccctgcaaatat 45169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 1105025 - 1104980
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | |||||||||||||| |||||||||||    
1105025 ttttgtgatgatttgcacacgtggcacatgatgattgaacccattt 1104980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 2217738 - 2217689
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||    
2217738 cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 2217689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5950292 - 5950345
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || ||||| || |||||||||    
5950292 cacttttgtgatgatttgcatacgtggcacattataactgatccaattttgtag 5950345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 6912495 - 6912528
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
6912495 atggctaaaatatggttttggtccctgcaaatat 6912528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 16038636 - 16038567
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||| ||||||||| ||| ||||| || |||||||| |||||||||    
16038636 aaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaattttgtag 16038567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 22551197 - 22551144
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||  |||||| |||| ||||||||||||||| ||||||||||    
22551197 cacttttgtgatgagctgcatacgtggtacatgatgactgaactcattttgtag 22551144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 27850257 - 27850204
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||| |||||||| ||||||||| || |||||||| |||||||||    
27850257 cacttttgtgatggtttgcatacgtggcacattataactgaaccaattttgtag 27850204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 28550945 - 28550998
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||||||  |||||||| || |||||||| |||||||||    
28550945 cacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtag 28550998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 29151636 - 29151689
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
29151636 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 29151689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 29172643 - 29172696
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||| ||||||||| || |||||||| |||||||||    
29172643 cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag 29172696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 29692973 - 29692920
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||| ||||||||| || |||||||| |||||||||    
29692973 cacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtag 29692920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 31037499 - 31037564
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
31037499 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 31037564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 37090638 - 37090569
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||  |||||||||    
37090638 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtag 37090569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 38496523 - 38496588
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
38496523 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 38496588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 38786261 - 38786329
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  ||||| ||||||||||||||||||| ||| ||||| || |||||| |||||||||||    
38786261 aaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaa-ccattttgtag 38786329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 38962974 - 38962921
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
38962974 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 38962921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 42207360 - 42207413
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
42207360 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 42207413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10830649 - 10830697
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| |||| |||||||||||||||||    
10830649 cacttttgtgatgatttgcacacgtgacacaagatgactgaacccattt 10830697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 198
Target Start/End: Original strand, 15916403 - 15916454
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||||||| ||||| ||||| |||| ||||||||||||    
15916403 cctcacttttgtgatgatttgcacatgtgacacat-atgaatgaacccatttt 15916454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20690851 - 20690899
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||||  ||||||||||||| ||||| |||||    
20690851 cacttttgtgatgatttgcatacatggcacatgatgaatgaactcattt 20690899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 35928459 - 35928427
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
35928459 tggctaaaatatggttttggtccctgcaaatat 35928427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 36973473 - 36973521
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||| ||||||    
36973473 cacttttgtgatgatttgcacacgtgacacatgatgactgaatccattt 36973521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1104858 - 1104889
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1104858 ggctaaaatatggttttggtccctgcaaatat 1104889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1105148 - 1105117
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1105148 ggctaaaatatggttttggtccctgcaaatat 1105117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1381247 - 1381278
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1381247 ggctaaaatatggttttggtccctgcaaatat 1381278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1381611 - 1381580
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1381611 ggctaaaatatggttttggtccctgcaaatat 1381580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 55
Target Start/End: Original strand, 2636668 - 2636699
Alignment:
24 tggctaaaatatggttttggtccctgcaaata 55  Q
    ||||||||||||||||||||||||||||||||    
2636668 tggctaaaatatggttttggtccctgcaaata 2636699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 4736542 - 4736511
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
4736542 ggctaaaatatggttttggtccctgcaaatat 4736511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 5917126 - 5917157
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
5917126 ggctaaaatatggttttggtccctgcaaatat 5917157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 5917460 - 5917429
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
5917460 ggctaaaatatggttttggtccctgcaaatat 5917429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 9588358 - 9588389
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
9588358 ggctaaaatatggttttggtccctgcaaatat 9588389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 17070535 - 17070566
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
17070535 ggctaaaatatggttttggtccctgcaaatat 17070566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 18258162 - 18258193
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
18258162 ggctaaaatatggttttggtccctgcaaatat 18258193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 18258527 - 18258496
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
18258527 ggctaaaatatggttttggtccctgcaaatat 18258496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19565467 - 19565498
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19565467 ggctaaaatatggttttggtccctgcaaatat 19565498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19565831 - 19565800
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19565831 ggctaaaatatggttttggtccctgcaaatat 19565800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19685017 - 19685048
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19685017 ggctaaaatatggttttggtccctgcaaatat 19685048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 19685136 - 19685179
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
19685136 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 19685179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19685380 - 19685349
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19685380 ggctaaaatatggttttggtccctgcaaatat 19685349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20660948 - 20660979
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
20660948 ggctaaaatatggttttggtccctgcaaatat 20660979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20690733 - 20690764
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
20690733 ggctaaaatatggttttggtccctgcaaatat 20690764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 20986089 - 20986058
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
20986089 ggctaaaatatggttttggtccctgcaaatat 20986058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 24443380 - 24443411
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
24443380 ggctaaaatatggttttggtccctgcaaatat 24443411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 24443500 - 24443543
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
24443500 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 24443543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 24443744 - 24443713
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
24443744 ggctaaaatatggttttggtccctgcaaatat 24443713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 28213373 - 28213404
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
28213373 ggctaaaatatggttttggtccctgcaaatat 28213404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 30888160 - 30888191
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
30888160 ggctaaaatatggttttggtccctgcaaatat 30888191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 32108808 - 32108839
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
32108808 ggctaaaatatggttttggtccctgcaaatat 32108839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35876688 - 35876719
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35876688 ggctaaaatatggttttggtccctgcaaatat 35876719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 35877052 - 35877021
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35877052 ggctaaaatatggttttggtccctgcaaatat 35877021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 35928064 - 35928095
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
35928064 ggctaaaatatggttttggtccctgcaaatat 35928095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 37271586 - 37271543
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
37271586 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 37271543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 37271706 - 37271675
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
37271706 ggctaaaatatggttttggtccctgcaaatat 37271675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 38170514 - 38170545
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
38170514 ggctaaaatatggttttggtccctgcaaatat 38170545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 40764415 - 40764446
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
40764415 ggctaaaatatggttttggtccctgcaaatat 40764446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 56
Target Start/End: Complemental strand, 45507 - 45473
Alignment:
22 catggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||| |||||||||||||||||||||||||||||    
45507 catggttaaaatatggttttggtccctgcaaatat 45473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 2636992 - 2636962
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
2636992 gctaaaatatggttttggtccctgcaaatat 2636962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 27916584 - 27916634
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||| ||||||||| ||| || |||||||||||||| |||||||||    
27916584 ttttgtgataatttgcatacgtgacagatgatgactgaaccaattttgtag 27916634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 29875522 - 29875568
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||| ||||||||| || |||||||| |||||    
29875522 ttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 29875568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 45380 - 45335
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| | |||| ||||||||||| |||||||||    
45380 ttttgtgatgatttgcacacgtggtacatgatgactaaacccattt 45335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 294073 - 294024
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||    
294073 cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt 294024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 5104003 - 5103970
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||| |||||||||||    
5104003 atggctaaaatatggttttggttcctgcaaatat 5103970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 6912855 - 6912826
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
6912855 ctaaaatatggttttggtccctgcaaatat 6912826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 10409050 - 10409103
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
10409050 cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag 10409103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 12145181 - 12145152
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
12145181 ctaaaatatggttttggtccctgcaaatat 12145152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 198
Target Start/End: Complemental strand, 18046248 - 18046183
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||  || |||||||||||| ||||||||| ||| ||||| || |||||||| |||||    
18046248 aaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaatttt 18046183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 21050915 - 21050882
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
21050915 atggctaaaatatggttttagtccctgcaaatat 21050882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 23382190 - 23382137
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || | |||||| |||||||||    
23382190 cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag 23382137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 25561703 - 25561736
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
25561703 atggctaaaatatggttttagtccctgcaaatat 25561736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 35609301 - 35609334
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||| |||||||||    
35609301 atggctaaaatatggttttggtccatgcaaatat 35609334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 35609635 - 35609606
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
35609635 ctaaaatatggttttggtccctgcaaatat 35609606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 38452394 - 38452365
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
38452394 ctaaaatatggttttggtccctgcaaatat 38452365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 39379348 - 39379401
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||| ||| ||||| || |||||||| |||||||||    
39379348 cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag 39379401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 40029499 - 40029466
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
40029499 atggctaaaatatggttttagtccctgcaaatat 40029466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 42553640 - 42553673
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||| |||||||||||||||||||    
42553640 atggctaaaatatgattttggtccctgcaaatat 42553673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 1286927 - 1286879
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||   ||| ||||| ||||||||||||||||    
1286927 cacttttgtgatgatttgcaagcgtgacacataatgactgaacccattt 1286879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 202
Target Start/End: Original strand, 2032735 - 2032775
Alignment:
162 atttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||| ||| |||||||||||||||| ||||||||||    
2032735 atttgcatacgtgacacatgatgactgaacacattttgtag 2032775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 3936578 - 3936610
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
3936578 ggctaaaatatgtttttggtccctgcaaatata 3936610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 6118500 - 6118468
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
6118500 tggctaaaatatggttttagtccctgcaaatat 6118468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 15916285 - 15916317
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||| |||||||||||||||||||||||    
15916285 tggctaaaagatggttttggtccctgcaaatat 15916317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 18633962 - 18633930
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
18633962 tggctaaaatatggttttagtccctgcaaatat 18633930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 20661068 - 20661116
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| |||||||||| ||||| |||||    
20661068 cacttttgtgatgatttgcacacgtgacacatgatgattgaactcattt 20661116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 20661312 - 20661280
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||| |||||||||    
20661312 tggctaaaatatggttttggtccgtgcaaatat 20661280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 20985728 - 20985756
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
20985728 taaaatatggttttggtccctgcaaatat 20985756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 25254188 - 25254156
Alignment:
27 ctaaaatatggttttggtccctgcaaatatata 59  Q
    |||||||||| ||||||||||||||||||||||    
25254188 ctaaaatatgcttttggtccctgcaaatatata 25254156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 25317978 - 25317946
Alignment:
27 ctaaaatatggttttggtccctgcaaatatata 59  Q
    |||||||||| ||||||||||||||||||||||    
25317978 ctaaaatatgcttttggtccctgcaaatatata 25317946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 27571188 - 27571156
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
27571188 ggctaaaatatgattttggtccctgcaaatata 27571156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 28550826 - 28550858
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
28550826 tggctaaaatatggttttagtccctgcaaatat 28550858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 28863839 - 28863807
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
28863839 tggctaaaatatggttttagtccctgcaaatat 28863807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 29366950 - 29366918
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
29366950 tggctaaaatatggttttagtccctgcaaatat 29366918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 31540496 - 31540528
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
31540496 ggctaaaatatgtttttggtccctgcaaatata 31540528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 33336027 - 33335995
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
33336027 tggctaaaatatggttttagtccctgcaaatat 33335995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 34911887 - 34911855
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
34911887 ggctaaaatatgattttggtccctgcaaatata 34911855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 40038859 - 40038827
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
40038859 tggctaaaatatgattttggtccctgcaaatat 40038827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 42596814 - 42596786
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
42596814 taaaatatggttttggtccctgcaaatat 42596786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 42994067 - 42994099
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
42994067 tggctaaaatatggttttagtccctgcaaatat 42994099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 1540 - 1471
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||||||||||||| || |||||||| |||||||||    
1540 aaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtag 1471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 110)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 12612255 - 12612186
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||| ||  || ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
12612255 aaatagtctctggctccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtag 12612186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 152 - 240
Target Start/End: Complemental strand, 19275919 - 19275832
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaata 240  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||        ||| ||||||||||||| ||||||||||||    
19275919 ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag-tttttggtccctgcaaaatattttgttttttaaaata 19275832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 23502294 - 23502345
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||||||||||    
23502294 cctcaattttgtgatgatttgcacatgtggcacatgatgactgaacccattt 23502345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 2373371 - 2373321
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||    
2373371 ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag 2373321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 133 - 199
Target Start/End: Original strand, 14428752 - 14428818
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttg 199  Q
    |||||||||||  || || ||||||||||||||||||| ||||||||||||||||||||| ||||||    
14428752 aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttg 14428818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 21995187 - 21995237
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||    
21995187 ttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtag 21995237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 23770400 - 23770350
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||| |||||||||||||||||||||||    
23770400 ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtag 23770350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 3414632 - 3414584
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||| ||||||| ||||||||||||||||||||||||||||    
3414632 cacttttgtgattatttgcacatgtggcacatgatgactgaacccattt 3414584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 19320887 - 19320935
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
19320887 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 19320935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 31198735 - 31198783
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
31198735 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 31198783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 6468550 - 6468500
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| ||||||||||||||||| |||||||||    
6468550 ttttgtgatgatttgcatacgtgacacatgatgactgaaccaattttgtag 6468500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 9896517 - 9896467
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||| |||||||||||||| |||||| ||||||||||||||||||||||||    
9896517 ttttatgatgatttgcatacgtggcatatgatgactgaacccattttgtag 9896467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 33131646 - 33131696
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||| ||||||||||||||||| |||||||||    
33131646 ttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttgtag 33131696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 777920 - 777867
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
777920 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 777867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 7155916 - 7155969
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
7155916 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 7155969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14655651 - 14655598
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
14655651 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 14655598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 19296287 - 19296234
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||| |||||||||||||| || |||||||| |||||||||    
19296287 cacttttgtgatgatttacatatgtggcacattataactgaaccaattttgtag 19296234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 24273957 - 24274010
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
24273957 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 24274010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 24692878 - 24692809
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| ||  ||||||||||||||||||||||||| ||||||||| || |||||||  |||||||||    
24692878 aaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaactaattttgtag 24692809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 32885776 - 32885845
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  ||  ||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
32885776 aaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 32885845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 33801624 - 33801571
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
33801624 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 33801571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 34582649 - 34582702
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
34582649 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 34582702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 12298938 - 12298986
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||| |||||||||||    
12298938 cacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt 12298986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13617649 - 13617697
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||| |||||||||||||    
13617649 cacttttgtgatgatttgcacacgtggcacatgataactgaacccattt 13617697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 23629042 - 23628994
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||| | | ||||||||||||||||||||||||||    
23629042 cacttttgtgatgatttgtacacgtggcacatgatgactgaacccattt 23628994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 201
Target Start/End: Original strand, 26375795 - 26375863
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 201  Q
    |||||||| ||  ||||||||||||||||||||||||| ||| ||||| || |||||||| ||||||||    
26375795 aaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta 26375863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 31185754 - 31185802
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
31185754 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 31185802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 1214815 - 1214862
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||| | ||| ||||||||||||||||||||||    
1214815 acttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 1214862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 19690516 - 19690563
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||| | ||||||||||||| ||||||||||||    
19690516 acttttgtgatgatttgcacacgtggcacatgatggctgaacccattt 19690563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 57
Target Start/End: Original strand, 15442935 - 15442969
Alignment:
23 atggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||||    
15442935 atggctaaaatatggttttggtccctgcaaatata 15442969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 132 - 198
Target Start/End: Original strand, 15962130 - 15962196
Alignment:
132 gaaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||| ||  || |||||||||||||||||||||| ||||||||| || |||||||| |||||    
15962130 gaaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 15962196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 317912 - 317981
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||   | |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
317912 aaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 317981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 543604 - 543551
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||  |||||||||    
543604 cacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtag 543551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 2616116 - 2616063
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
2616116 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 2616063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 8680895 - 8680948
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || ||| |||| |||||||||    
8680895 cacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtag 8680948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 11129320 - 11129369
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| |||||| ||||| |||||||| |||||    
11129320 cacttttgtgatgatttgcatacgtggcagatgataactgaaccaatttt 11129369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 15116791 - 15116844
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
15116791 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 15116844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 17321435 - 17321386
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||    
17321435 cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 17321386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 17321568 - 17321519
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||    
17321568 cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 17321519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 20897557 - 20897524
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||||||||||||||||||||    
20897557 tggctaaaatatggttttggtccctgcaaatata 20897524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 31166989 - 31167042
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||| ||||||||| || |||||||| |||||||||    
31166989 cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag 31167042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 3276234 - 3276186
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||| ||||||||||||    
3276234 cacttttgtgatgatttgcacacgtgacacatgatgtctgaacccattt 3276186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 10910844 - 10910796
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | |||||||||||||||| |||||||||    
10910844 cacttttgtgatgatttacacacgtggcacatgatgactaaacccattt 10910796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 58
Target Start/End: Original strand, 23628799 - 23628831
Alignment:
26 gctaaaatatggttttggtccctgcaaatatat 58  Q
    |||||||||||||||||||||||||||||||||    
23628799 gctaaaatatggttttggtccctgcaaatatat 23628831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 24901238 - 24901270
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
24901238 tggctaaaatatggttttggtccctgcaaatat 24901270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 24901358 - 24901406
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| |||||||| |||||||||||||    
24901358 cacttttgtgatgatttgcacacgtgacacatgataactgaacccattt 24901406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 25137113 - 25137161
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||| || |||||||||    
25137113 cacttttgtgatgatttgcacacgtggcacatgatggctaaacccattt 25137161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 31398422 - 31398370
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgta 201  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| ||||||||    
31398422 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta 31398370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 56
Target Start/End: Original strand, 34582520 - 34582560
Alignment:
16 taacttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||| ||||||||||||||||||| ||||||||||||||    
34582520 taactttatggctaaaatatggttttagtccctgcaaatat 34582560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 1007124 - 1007155
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1007124 ggctaaaatatggttttggtccctgcaaatat 1007155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 1007509 - 1007478
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
1007509 ggctaaaatatggttttggtccctgcaaatat 1007478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3276354 - 3276323
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3276354 ggctaaaatatggttttggtccctgcaaatat 3276323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3414387 - 3414418
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3414387 ggctaaaatatggttttggtccctgcaaatat 3414418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3968645 - 3968676
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3968645 ggctaaaatatggttttggtccctgcaaatat 3968676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 3968765 - 3968808
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
3968765 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 3968808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 3969009 - 3968978
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3969009 ggctaaaatatggttttggtccctgcaaatat 3968978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 176
Target Start/End: Original strand, 5286689 - 5286732
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggc 176  Q
    |||||||| || ||| ||||||||||||||||||||||||||||    
5286689 aaatagtccctggccccacttttgtgatgatttgcatatgtggc 5286732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 6412218 - 6412249
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
6412218 ggctaaaatatggttttggtccctgcaaatat 6412249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 6412579 - 6412548
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
6412579 ggctaaaatatggttttggtccctgcaaatat 6412548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 8170151 - 8170120
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
8170151 ggctaaaatatggttttggtccctgcaaatat 8170120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 10910964 - 10910933
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
10910964 ggctaaaatatggttttggtccctgcaaatat 10910933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 12299140 - 12299109
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12299140 ggctaaaatatggttttggtccctgcaaatat 12299109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 12757610 - 12757641
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
12757610 ggctaaaatatggttttggtccctgcaaatat 12757641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13268109 - 13268140
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
13268109 ggctaaaatatggttttggtccctgcaaatat 13268140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 17765009 - 17765040
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
17765009 ggctaaaatatggttttggtccctgcaaatat 17765040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 18024131 - 18024178
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||| |||||||||||||||  |||| ||||||    
18024131 acttttgtgatgatttgcacatgtggcacatgatgcttgaatccattt 18024178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 18024375 - 18024344
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
18024375 ggctaaaatatggttttggtccctgcaaatat 18024344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 19321131 - 19321100
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19321131 ggctaaaatatggttttggtccctgcaaatat 19321100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 19690393 - 19690424
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
19690393 ggctaaaatatggttttggtccctgcaaatat 19690424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 20467718 - 20467687
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
20467718 ggctaaaatatggttttggtccctgcaaatat 20467687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21147404 - 21147435
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
21147404 ggctaaaatatggttttggtccctgcaaatat 21147435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 21385251 - 21385282
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
21385251 ggctaaaatatggttttggtccctgcaaatat 21385282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 21385584 - 21385553
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
21385584 ggctaaaatatggttttggtccctgcaaatat 21385553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 21994403 - 21994372
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
21994403 ggctaaaatatggttttggtccctgcaaatat 21994372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 22543354 - 22543385
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
22543354 ggctaaaatatggttttggtccctgcaaatat 22543385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 22543718 - 22543687
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
22543718 ggctaaaatatggttttggtccctgcaaatat 22543687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 23502237 - 23502268
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
23502237 ggctaaaatatggttttggtccctgcaaatat 23502268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25137357 - 25137326
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25137357 ggctaaaatatggttttggtccctgcaaatat 25137326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 31198615 - 31198646
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
31198615 ggctaaaatatggttttggtccctgcaaatat 31198646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 195
Target Start/End: Complemental strand, 12757817 - 12757771
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccat 195  Q
    |||||||||||||  ||||| ||||| ||||||||||||||||||||    
12757817 cacttttgtgatgggttgcacatgtgacacatgatgactgaacccat 12757771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 195
Target Start/End: Original strand, 14656023 - 14656069
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccat 195  Q
    ||||||||||| |||||||| ||||| |||||||| |||||||||||    
14656023 cacttttgtgacgatttgcacatgtgacacatgatcactgaacccat 14656069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 15962400 - 15962358
Alignment:
14 aataacttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||| ||| |||||||||||||||||| ||||||||||||||    
15962400 aataaattcttggctaaaatatggttttagtccctgcaaatat 15962358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 58
Target Start/End: Complemental strand, 27765173 - 27765143
Alignment:
28 taaaatatggttttggtccctgcaaatatat 58  Q
    |||||||||||||||||||||||||||||||    
27765173 taaaatatggttttggtccctgcaaatatat 27765143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 494643 - 494590
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||| |||||| ||||||||| || |||||| | |||||||||    
494643 cacttttgtgatgatctgcatacgtggcacattataactgaatcaattttgtag 494590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 6591322 - 6591269
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
6591322 cacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtag 6591269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 7324074 - 7324021
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||| | ||||||| || |||||||| |||||||||    
7324074 cacttttatgatgatttgcatacggggcacattataactgaaccaattttgtag 7324021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 13617531 - 13617560
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
13617531 ctaaaatatggttttggtccctgcaaatat 13617560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 14655903 - 14655936
Alignment:
25 ggctaaaatatggttttggtccctgcaaatatat 58  Q
    |||||||| |||||||||||||||||||||||||    
14655903 ggctaaaacatggttttggtccctgcaaatatat 14655936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 15076085 - 15076032
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||| |||||||||||||| ||| ||||| || |||||||| |||||||||    
15076085 cacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtag 15076032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 17771909 - 17771942
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
17771909 atggctaaaatatggttttagtccctgcaaatat 17771942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 19267563 - 19267596
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||| ||||||    
19267563 atggctaaaatatggttttggtccctgtaaatat 19267596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 19320769 - 19320798
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
19320769 ctaaaatatggttttggtccctgcaaatat 19320798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 21165245 - 21165278
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||| ||||||||||||||||||||    
21165245 tggctaaaatatgcttttggtccctgcaaatata 21165278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 30928926 - 30928873
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
30928926 cacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtag 30928873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 494404 - 494436
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
494404 tggctaaaatatggttttagtccctgcaaatat 494436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 2615872 - 2615904
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||| |||||||||||||||    
2615872 ggctaaaatatggttttagtccctgcaaatata 2615904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 3276367 - 3276399
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
3276367 ggctaaaatatgtttttggtccctgcaaatata 3276399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 8170029 - 8169985
Alignment:
153 tttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||| | ||| |||||||||||||||| |||||    
8170029 tttgtgatgatttgcacacgtgacacatgatgactgaactcattt 8169985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 12298825 - 12298853
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
12298825 taaaatatggttttggtccctgcaaatat 12298853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 13268461 - 13268429
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||| |||||||||||||||||||||    
13268461 tggctaaaataaggttttggtccctgcaaatat 13268429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 16995451 - 16995483
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
16995451 ggctaaaatatgtttttggtccctgcaaatata 16995483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 133 - 185
Target Start/End: Original strand, 17772016 - 17772068
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatga 185  Q
    |||||||||||  || || ||||||||||||||||||| |||||||| |||||    
17772016 aaatagtctctgaccccatttttgtgatgatttgcatacgtggcacaagatga 17772068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 18810532 - 18810564
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
18810532 ggctaaaatatgattttggtccctgcaaatata 18810564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 19296408 - 19296376
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
19296408 tggctaaaatatggttttagtccctgcaaatat 19296376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 19690760 - 19690728
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| ||||||||||||||||||||||||||||    
19690760 tggcgaaaatatggttttggtccctgcaaatat 19690728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 21953206 - 21953238
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
21953206 ggctaaaatatgcttttggtccctgcaaatata 21953238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Complemental strand, 25121377 - 25121337
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactga 189  Q
    |||||||||||||||||||| | ||| ||||||||||||||    
25121377 cacttttgtgatgatttgcacacgtgacacatgatgactga 25121337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 30479179 - 30479227
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||| ||||||  | ||| ||||||||||||||||||||||    
30479179 cacttttgtgataatttgcgcacgtgacacatgatgactgaacccattt 30479227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 31167201 - 31167169
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
31167201 tggctaaaatatggttttagtccctgcaaatat 31167169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 34582892 - 34582860
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||||||| |||||||||||||||    
34582892 ggctaaaatatggttttagtccctgcaaatata 34582860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 137)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 43597379 - 43597294
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaa 238  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||        ||| ||||||||||||||||||||||||    
43597379 ttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtag-tttttggtccctgcaaaatattttattttttaaaa 43597294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 32691434 - 32691484
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||| |||||||||||||||||||||||    
32691434 ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtag 32691484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 24483501 - 24483570
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| |||||||| |||||||| |||||||||    
24483501 aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaattttgtag 24483570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 1295427 - 1295379
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |||||||||||||||||||||| |||||    
1295427 cacttttgtgatgatttgcacatgtggcacatgatgactgaactcattt 1295379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4424015 - 4424063
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
4424015 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 4424063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 13215305 - 13215257
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| ||||||||||||||||||||||||||||    
13215305 cacttttatgatgatttgcacatgtggcacatgatgactgaacccattt 13215257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16523109 - 16523157
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
16523109 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 16523157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 23732209 - 23732161
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
23732209 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 23732161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 27109162 - 27109210
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
27109162 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 27109210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 37911000 - 37910952
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| |||||||| |||||||||||||||||||    
37911000 cacttttgtgatgatttgcacatgtggcatatgatgactgaacccattt 37910952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 40125086 - 40125134
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
40125086 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40125134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 34317907 - 34317966
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| |||||||||||||||||||| | ||| ||||||||||||||||||||||    
34317907 gtctctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 34317966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 43592167 - 43592217
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||| ||||||| ||||||||    
43592167 ttttgtgatgatttgcatacgtggcacatgatgattgaacccgttttgtag 43592217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 45442435 - 45442485
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||| ||||||||| ||||||||||||||||||||| |||||||||    
45442435 ttttgtgattatttgcatacgtggcacatgatgactgaaccgattttgtag 45442485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 3838144 - 3838091
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
3838144 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 3838091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 7814503 - 7814434
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
7814503 aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtag 7814434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 7814636 - 7814567
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
7814636 aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtag 7814567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 8046432 - 8046501
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
8046432 aaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 8046501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 17541657 - 17541604
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
17541657 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 17541604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 19183902 - 19183955
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
19183902 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 19183955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 23989955 - 23990008
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
23989955 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 23990008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 24483650 - 24483703
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
24483650 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 24483703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 26238914 - 26238979
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||| || ||| |||||||||||||||||||||| ||||||||| || |||||||| |||||    
26238914 aaatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaatttt 26238979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 26814109 - 26814056
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
26814109 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 26814056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 35155412 - 35155465
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| ||||||||||| ||||| |||||||||||||||| ||||||||||    
35155412 cacttttgggatgatttgcacatgtgccacatgatgactgaactcattttgtag 35155465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 37271983 - 37271930
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
37271983 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 37271930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 38980134 - 38980081
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
38980134 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 38980081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 43710482 - 43710551
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| ||  ||||||||||||||||||||||||| ||||||||| || |||||||  |||||||||    
43710482 aaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtag 43710551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 1138102 - 1138150
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
1138102 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 1138150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4842951 - 4842999
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | ||||||||||||||||||||||||||    
4842951 cacttttgtgatgattttcacacgtggcacatgatgactgaacccattt 4842999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 10671750 - 10671798
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||||||||||||||||||||||||||    
10671750 cacttttctgatgatttgcacacgtggcacatgatgactgaacccattt 10671798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 20939205 - 20939157
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | ||||||||||||||||||||||||||    
20939205 cacttttgtgatgatttacacacgtggcacatgatgactgaacccattt 20939157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 25750846 - 25750798
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||||||| |||||    
25750846 cacttttgtgatgatttgcacacgtggcacatgatgactgaactcattt 25750798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 31909359 - 31909311
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||||||||||||||    
31909359 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 31909311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 35686221 - 35686173
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | || |||||||||||||||||||||||    
35686221 cacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt 35686173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 38231551 - 38231599
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||| ||||||| ||||||||||||||||||||| ||||||    
38231551 cacttttgtgataatttgcacatgtggcacatgatgactgaatccattt 38231599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 43672052 - 43672100
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||| ||||||| | ||||||||||||||||||||||||||    
43672052 cacttttgtgattatttgcacacgtggcacatgatgactgaacccattt 43672100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 3832380 - 3832439
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| |||||||||||||||||||| | ||| ||||||||||||||||| ||||    
3832380 gtctctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt 3832439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 5164387 - 5164328
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| | |||||||||||||||||||||| | ||| ||||||||||||||||| ||||    
5164387 gtctctggtctcacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt 5164328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 34964052 - 34963993
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||| ||| ||||||||| |||||||||| | ||| ||||||||||||||||||||||    
34964052 gtctctggccccacttttgtaatgatttgcacacgtgacacatgatgactgaacccattt 34963993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 31326129 - 31326080
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| |||||||||||||||||  ||||||||||||    
31326129 ttttgtgatgatttgcatacgtggcacatgatgactg-gcccattttgtag 31326080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 44993937 - 44993887
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||||||| ||||||||||||||| |||| ||||| ||||    
44993937 ttttgtgatgatttgcatacgtggcacatgatgaccgaactcatttcgtag 44993887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 146692 - 146659
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
146692 atggctaaaatatggttttggtccctgcaaatat 146659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 4042771 - 4042722
Alignment:
148 tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||||| | ||| ||||||||||||||||| ||||    
4042771 tcacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt 4042722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 5335042 - 5335009
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
5335042 atggctaaaatatggttttggtccctgcaaatat 5335009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 5790779 - 5790730
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||    
5790779 cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 5790730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 10671630 - 10671663
Alignment:
25 ggctaaaatatggttttggtccctgcaaatatat 58  Q
    ||||||||||||||||||||||||||||||||||    
10671630 ggctaaaatatggttttggtccctgcaaatatat 10671663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 14393011 - 14392958
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| ||||||||||||| || |||||||  |||||||||    
14393011 cacttttgtgatgatttgtatatgtggcacattataactgaactaattttgtag 14392958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 16900014 - 16900067
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||  |||||||||    
16900014 cacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtag 16900067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 16993405 - 16993458
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||  |||||||||    
16993405 cacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtag 16993458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 20131683 - 20131650
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||||    
20131683 atggctaaaatatggttttggtccctgcaaatat 20131650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 20658178 - 20658231
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||| ||||||||| ||||||||| || |||||||| |||||||||    
20658178 cacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtag 20658231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 30215871 - 30215838
Alignment:
25 ggctaaaatatggttttggtccctgcaaatatat 58  Q
    ||||||||||||||||||||||||||||||||||    
30215871 ggctaaaatatggttttggtccctgcaaatatat 30215838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 38731946 - 38731999
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||| |||||||||    
38731946 cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtag 38731999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 40302095 - 40302148
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || ||| |||| |||||||||    
40302095 cacttttgtgatgatttgcatacgtggcacattataactcaaccaattttgtag 40302148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 43789072 - 43789019
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| |||||| || || |||||||| |||||||||    
43789072 cacttttgtgatgatttgcatacgtggcatattatcactgaaccaattttgtag 43789019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 4794250 - 4794298
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| ||||||||| || | ||||||||||||||||||||||||||    
4794250 cacttttatgatgatttacacacgtggcacatgatgactgaacccattt 4794298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 5334750 - 5334782
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
5334750 tggctaaaatatggttttggtccctgcaaatat 5334782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 13850640 - 13850688
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| |||||||||| |||||||||||    
13850640 cacttttgtgatgatttgcacacgtgacacatgatgattgaacccattt 13850688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 202
Target Start/End: Original strand, 33732979 - 33733031
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||| |||||||||||||| ||||||||| || |||||||| |||||||||    
33732979 acttttatgatgatttgcatacgtggcacattataactgaaccaattttgtag 33733031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 34964160 - 34964128
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
34964160 tggctaaaatatggttttggtccctgcaaatat 34964128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 40124965 - 40124997
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
40124965 tggctaaaatatggttttggtccctgcaaatat 40124997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 42695867 - 42695899
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||    
42695867 tggctaaaatatggttttggtccctgcaaatat 42695899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 44559289 - 44559241
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||| | ||| ||||||||||||||||||||||    
44559289 cacttttctgatgatttgcacacgtgacacatgatgactgaacccattt 44559241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 2481313 - 2481356
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
2481313 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 2481356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 2481557 - 2481526
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
2481557 ggctaaaatatggttttggtccctgcaaatat 2481526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 4423895 - 4423926
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
4423895 ggctaaaatatggttttggtccctgcaaatat 4423926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 4424185 - 4424154
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
4424185 ggctaaaatatggttttggtccctgcaaatat 4424154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 13215060 - 13215091
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
13215060 ggctaaaatatggttttggtccctgcaaatat 13215091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 14003409 - 14003440
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14003409 ggctaaaatatggttttggtccctgcaaatat 14003440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 14003742 - 14003711
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
14003742 ggctaaaatatggttttggtccctgcaaatat 14003711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 15842823 - 15842792
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
15842823 ggctaaaatatggttttggtccctgcaaatat 15842792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 16522991 - 16523022
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
16522991 ggctaaaatatggttttggtccctgcaaatat 16523022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 16523325 - 16523294
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
16523325 ggctaaaatatggttttggtccctgcaaatat 16523294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 16673411 - 16673442
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
16673411 ggctaaaatatggttttggtccctgcaaatat 16673442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 16673771 - 16673740
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
16673771 ggctaaaatatggttttggtccctgcaaatat 16673740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 18113089 - 18113120
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
18113089 ggctaaaatatggttttggtccctgcaaatat 18113120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 20131317 - 20131348
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
20131317 ggctaaaatatggttttggtccctgcaaatat 20131348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 24358616 - 24358647
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
24358616 ggctaaaatatggttttggtccctgcaaatat 24358647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 25705085 - 25705116
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25705085 ggctaaaatatggttttggtccctgcaaatat 25705116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 25705449 - 25705418
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
25705449 ggctaaaatatggttttggtccctgcaaatat 25705418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 29859872 - 29859841
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
29859872 ggctaaaatatggttttggtccctgcaaatat 29859841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 30215422 - 30215453
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
30215422 ggctaaaatatggttttggtccctgcaaatat 30215453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 31644841 - 31644872
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
31644841 ggctaaaatatggttttggtccctgcaaatat 31644872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 31909478 - 31909447
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
31909478 ggctaaaatatggttttggtccctgcaaatat 31909447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 33576117 - 33576086
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
33576117 ggctaaaatatggttttggtccctgcaaatat 33576086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 36815713 - 36815666
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||||| | ||| ||||||||||||||| ||||||    
36815713 acttttgtgatgatttgcacacgtgacacatgatgactgaatccattt 36815666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 37228733 - 37228764
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
37228733 ggctaaaatatggttttggtccctgcaaatat 37228764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 37911120 - 37911089
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
37911120 ggctaaaatatggttttggtccctgcaaatat 37911089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 41451837 - 41451868
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
41451837 ggctaaaatatggttttggtccctgcaaatat 41451868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 41451957 - 41452000
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    |||||||||||| ||||||| | |||||||||||||||||||||    
41451957 cacttttgtgataatttgcacacgtggcacatgatgactgaacc 41452000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 44559062 - 44559093
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
44559062 ggctaaaatatggttttggtccctgcaaatat 44559093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 1137970 - 1138012
Alignment:
14 aataacttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||| |||| | ||||||||||||||||||||||||||||||    
1137970 aataaattcaagactaaaatatggttttggtccctgcaaatat 1138012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 192
Target Start/End: Original strand, 1696238 - 1696284
Alignment:
146 cctcacttttgtgatgatttgcatatgtggcacatgatgactgaacc 192  Q
    ||||||||||||||||||||  | | |||||||||||||||||||||    
1696238 cctcacttttgtgatgatttaaacacgtggcacatgatgactgaacc 1696284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 197
Target Start/End: Original strand, 7121069 - 7121119
Alignment:
147 ctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||||| | ||| |||||||||| | |||||||||    
7121069 ctcacttttgtgatgatttgcacacgtgacacatgatgattaaacccattt 7121119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 56
Target Start/End: Complemental strand, 20939324 - 20939294
Alignment:
26 gctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||    
20939324 gctaaaatatggttttggtccctgcaaatat 20939294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 58
Target Start/End: Complemental strand, 37229039 - 37229009
Alignment:
28 taaaatatggttttggtccctgcaaatatat 58  Q
    |||||||||||||||||||||||||||||||    
37229039 taaaatatggttttggtccctgcaaatatat 37229009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 58
Target Start/End: Original strand, 38979888 - 38979922
Alignment:
24 tggctaaaatatggttttggtccctgcaaatatat 58  Q
    |||||||||||||||||| ||||||||||||||||    
38979888 tggctaaaatatggttttagtccctgcaaatatat 38979922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Original strand, 146328 - 146357
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
146328 ctaaaatatggttttggtccctgcaaatat 146357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 1497825 - 1497776
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| |||| |||| || |||||||| |||||    
1497825 cacttttgtgatgatttgcatacgtggtacattataactgaaccaatttt 1497776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 3172141 - 3172186
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||| |||||||||||| ||||||| |||||||||||||| |||||    
3172141 ttttatgatgatttgcacatgtggcgcatgatgactgaactcattt 3172186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 3172289 - 3172334
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||| |||||||||||| ||||||| |||||||||||||| |||||    
3172289 ttttatgatgatttgcacatgtggcgcatgatgactgaactcattt 3172334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 9195052 - 9195085
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
9195052 atggctaaaatatggttttagtccctgcaaatat 9195085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 10375071 - 10375038
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
10375071 atggctaaaatatggttttagtccctgcaaatat 10375038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 10665086 - 10665155
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || ||||||||||||||||| |||| |||| |||| || |||||| | |||||||||    
10665086 aaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaagcaattttgtag 10665155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 13802618 - 13802659
Alignment:
157 tgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||| ||||||| |||||| |||||||    
13802618 tgatgatttgcatatgtggtacatgataactgaatccatttt 13802659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 22881851 - 22881798
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || ||| |||| |||||||||    
22881851 cacttttgtgatgatttgcatacgtgtcacattataactaaaccaattttgtag 22881798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 25300038 - 25300009
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
25300038 ctaaaatatggttttggtccctgcaaatat 25300009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 25954307 - 25954254
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||  ||||| || |||||||| |||||||||    
25954307 cacttttgtgatgatttgcatacgtaacacattataactgaaccaattttgtag 25954254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 26707990 - 26708043
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || |||||||  |||||||||    
26707990 cacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtag 26708043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 36806898 - 36806865
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||| ||||||||||||||||||||||||||||    
36806898 atggccaaaatatggttttggtccctgcaaatat 36806865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 40786579 - 40786632
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || | |||||| |||||||||    
40786579 cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag 40786632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 44559407 - 44559378
Alignment:
27 ctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatat 44559378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 44985740 - 44985793
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||| | || |||||||| |||||||||    
44985740 cacttttgtgatgatttgcatacgtgacacgttataactgaaccaattttgtag 44985793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 1777469 - 1777501
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
1777469 ggctaaaatatgtttttggtccctgcaaatata 1777501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 2412487 - 2412455
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
2412487 ggctaaaatatgtttttggtccctgcaaatata 2412455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 3832634 - 3832606
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
3832634 taaaatatggttttggtccctgcaaatat 3832606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 4042891 - 4042859
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||| |||||||||||||||    
4042891 tggctaaaatatggtttaggtccctgcaaatat 4042859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 5790900 - 5790868
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
5790900 tggctaaaatatggttttagtccctgcaaatat 5790868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 11713484 - 11713516
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
11713484 tggctaaaatatggttttagtccctgcaaatat 11713516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 191
Target Start/End: Original strand, 11788174 - 11788214
Alignment:
151 cttttgtgatgatttgcatatgtggcacatgatgactgaac 191  Q
    |||||||||||||||||| ||||| |||||||| |||||||    
11788174 cttttgtgatgatttgcacatgtgacacatgataactgaac 11788214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 198
Target Start/End: Original strand, 12835446 - 12835494
Alignment:
150 acttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    ||||||||||||||||||||| ||||||||| || || ||||| |||||    
12835446 acttttgtgatgatttgcatacgtggcacattataacggaaccaatttt 12835494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 15842464 - 15842492
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
15842464 taaaatatggttttggtccctgcaaatat 15842492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 18113209 - 18113257
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||||||||||||| || | || ||||||||||| |||||||||||    
18113209 cacttttgtgatgatttacacacgtagcacatgatgagtgaacccattt 18113257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 18113455 - 18113423
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||| |||||||    
18113455 tggctaaaatatggttttggtccctacaaatat 18113423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 25977870 - 25977902
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
25977870 ggctaaaatatgtttttggtccctgcaaatata 25977902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 25979310 - 25979278
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
25979310 ggctaaaatatgtttttggtccctgcaaatata 25979278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 26813865 - 26813897
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
26813865 tggctaaaatatggttttagtccctgcaaatat 26813897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 27109072 - 27109104
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||| |||||||    
27109072 tggctaaaatatggttttggtccctacaaatat 27109104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 29182288 - 29182336
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||||||| |||| |||||    
29182288 cacttttgtgatgatttgcacacgtgacacatgatgaccgaactcattt 29182336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 29859490 - 29859518
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
29859490 taaaatatggttttggtccctgcaaatat 29859518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 32476090 - 32476126
Alignment:
20 ttcatggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| |||||||||||||||||| |||||||||||||    
32476090 ttcaaggctaaaatatggttttgatccctgcaaatat 32476126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 33733242 - 33733210
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
33733242 tggctaaaatatggttttagtccctgcaaatat 33733210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 34317797 - 34317829
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||| |||||||||||||||||||    
34317797 tggctaaaatatgattttggtccctgcaaatat 34317829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 34318084 - 34318052
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||| |||||||    
34318084 tggctaaaatatggttttggtccctacaaatat 34318052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 41791313 - 41791281
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
41791313 tggctaaaatatggttttagtccctgcaaatat 41791281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 42695988 - 42696036
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||| ||||||  ||||||||||||||    
42695988 cacttttgtgatgatttgcacacgtgacacatgtagactgaacccattt 42696036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 16843 - 16891
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||    
16843 cacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt 16891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 58
Target Start/End: Original strand, 16723 - 16757
Alignment:
24 tggctaaaatatggttttggtccctgcaaatatat 58  Q
    ||||||||||||| |||||||||||||||||||||    
16723 tggctaaaatatgattttggtccctgcaaatatat 16757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 14799 - 14868
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||| || ||| |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
14799 aaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 14868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 2415 - 2463
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||    
2415 cacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 2463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 2660 - 2629
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
2660 ggctaaaatatggttttggtccctgcaaatat 2629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 34965 - 34917
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    ||||||| |||||||||||||||||| ||||||||||||||||||||||    
34965 cacttttatgatgatttgcatatgtgacacatgatgactgaacccattt 34917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 148006 - 148054
Alignment:
148 tcacttttgtgatgatttgcatatgtggcacatgatgactgaacccatt 196  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||    
148006 tcacttttgtgatgatttgcacacgtggcacatgatgactgaacccatt 148054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 148282 - 148251
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
148282 ggctaaaatatggttttggtccctgcaaatat 148251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 119592 - 119625
Alignment:
24 tggctaaaatatggttttggtccctgcaaatata 57  Q
    ||||||||||||| ||||||||||||||||||||    
119592 tggctaaaatatgcttttggtccctgcaaatata 119625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 121044 - 121012
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
121044 ggctaaaatatgcttttggtccctgcaaatata 121012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 366154 - 366104
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||| ||| ||||||||||||||||||||| |||||||||    
366154 ttttgtgatgatttgtatacgtggcacatgatgactgaacctattttgtag 366104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5329 - 5382
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
5329 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 5349 - 5402
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
5349 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 8667 - 8720
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
8667 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 8720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 170 - 117
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||||||    
170 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 242
Target Start/End: Complemental strand, 17839 - 17752
Alignment:
154 ttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagnnnnnnnntccttgcaaaatattttattttttaaaatagt 242  Q
    ||||||||||||||||| |||| ||||| ||||||||| ||||||||||        |||||||||||||| || ||||||||||||||    
17839 ttgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag-aaaaaagtccttgcaaaatatattgttttttaaaatagt 17752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 17967 - 17935
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
17967 tggctaaaatatggttttagtccctgcaaatat 17935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 56
Target Start/End: Complemental strand, 2886 - 2852
Alignment:
22 catggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||||||||    
2886 catggctaaaatatggttttggtccctgcaaatat 2852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 2622 - 2670
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||| ||||||| | |||||||||||||||||||| |||||    
2622 cacttttgtgattatttgcacacgtggcacatgatgactgaactcattt 2670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 8905 - 8856
Alignment:
153 tttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| ||||||||| || |||||||| |||||||||    
8905 tttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 8856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0472
Description:

Target: scaffold0472; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 138 - 191
Target Start/End: Original strand, 7054 - 7107
Alignment:
138 gtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaac 191  Q
    |||||| ||| |||||||||||||||||||| ||||| ||||||||||| ||||    
7054 gtctctggccccacttttgtgatgatttgcacatgtgacacatgatgacggaac 7107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 4194 - 4141
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| ||| ||||||||| || |||||||| |||||||||    
4194 cacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtag 4141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 4313 - 4281
Alignment:
24 tggctaaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||| ||||||||||||||    
4313 tggctaaaatatggttttagtccctgcaaatat 4281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0204 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0204
Description:

Target: scaffold0204; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 17245 - 17294
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||| ||||| ||||||||||| |||| ||||||    
17245 cacttttgtgatgatttgcaaatgtgacacatgatgaccgaactcatttt 17294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 202
Target Start/End: Complemental strand, 3189 - 3120
Alignment:
133 aaatagtctctcgcctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||  || |||||||||||||||||||||| |||| |||| || |||||| | |||||||||    
3189 aaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaatcaattttgtag 3120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 35152 - 35103
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt 198  Q
    |||||||||||||||||||||| ||||||||| || |||||||| |||||    
35152 cacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 35103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 5583 - 5534
Alignment:
153 tttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| ||||||||| || |||||||| |||||||||    
5583 tttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 12302 - 12355
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||| ||| ||||||||| || |||||||| |||||||||    
12302 cacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtag 12355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0106 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0106
Description:

Target: scaffold0106; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 30966 - 30934
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||||||||||||||||||||||    
30966 ggctaaaatatggttttggtccctgcaaatata 30934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 82461 - 82509
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||||||||||||| |||| ||||    
82461 cacttttgtgatgatttgcacacgtggcacatgatgactaaaccaattt 82509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 82706 - 82675
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
82706 ggctaaaatatggttttggtccctgcaaatat 82675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 55
Target Start/End: Original strand, 82341 - 82371
Alignment:
25 ggctaaaatatggttttggtccctgcaaata 55  Q
    |||||||||||||||||||||||||||||||    
82341 ggctaaaatatggttttggtccctgcaaata 82371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 189448 - 189496
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | |||||| ||||||| |||||||||||    
189448 cacttttgtgatgatttgcacacgtggcatatgatgattgaacccattt 189496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 27364 - 27333
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
27364 ggctaaaatatggttttggtccctgcaaatat 27333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 3752 - 3783
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
3752 ggctaaaatatggttttggtccctgcaaatat 3783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 3871 - 3918
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||| ||| | |||||||||||||||||||| |||||    
3871 cacttttgtgatgatt-gcacacgtggcacatgatgactgaactcattt 3918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 147 - 202
Target Start/End: Complemental strand, 3803 - 3748
Alignment:
147 ctcacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||| |||||| |||||||||||| |||||||||||||||| |||  |||||||||    
3803 ctcatttttgttatgatttgcatacgtggcacatgatgactaaactgattttgtag 3748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 3530 - 3563
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
3530 atggctaaaatatggttttagtccctgcaaatat 3563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 75764 - 75733
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
75764 ggctaaaatatggttttggtccctgcaaatat 75733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 47925 - 47956
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
47925 ggctaaaatatggttttggtccctgcaaatat 47956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 223172 - 223141
Alignment:
25 ggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||||||||||||||||    
223172 ggctaaaatatggttttggtccctgcaaatat 223141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 48228 - 48200
Alignment:
28 taaaatatggttttggtccctgcaaatat 56  Q
    |||||||||||||||||||||||||||||    
48228 taaaatatggttttggtccctgcaaatat 48200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 2898 - 2948
Alignment:
152 ttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    ||||||||||||||| ||| |||||||| |||||||| ||||| |||||||    
2898 ttttgtgatgatttgtatacgtggcacaagatgactggacccaatttgtag 2948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0517 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0517
Description:

Target: scaffold0517; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Original strand, 10313 - 10347
Alignment:
23 atggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||||| ||||||||||||||||||||    
10313 atggctaaaatatgcttttggtccctgcaaatata 10347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0517; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 11581 - 11549
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
11581 ggctaaaatatgtttttggtccctgcaaatata 11549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 12523 - 12556
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    ||||||||||||||||||| ||||||||||||||    
12523 atggctaaaatatggttttagtccctgcaaatat 12556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 17924 - 17871
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||| | || |||||||| |||||||||    
17924 cacttttgtgatgatttgcatacgtgtcactttataactgaaccaattttgtag 17871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 50080 - 50047
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| |||||||||||||||||||||||||||||    
50080 atggttaaaatatggttttggtccctgcaaatat 50047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 55181 - 55148
Alignment:
23 atggctaaaatatggttttggtccctgcaaatat 56  Q
    |||| |||||||||||||||||||||||||||||    
55181 atggttaaaatatggttttggtccctgcaaatat 55148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 10275 - 10328
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtag 202  Q
    |||||||||||||||||||||| ||| ||||| || | |||||| |||||||||    
10275 cacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtag 10328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0230 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0230
Description:

Target: scaffold0230; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 490 - 458
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
490 ggctaaaatatgattttggtccctgcaaatata 458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 21810 - 21858
Alignment:
149 cacttttgtgatgatttgcatatgtggcacatgatgactgaacccattt 197  Q
    |||||||||||||||||||| | ||||||| |||||| |||||| ||||    
21810 cacttttgtgatgatttgcacacgtggcacgtgatgattgaaccaattt 21858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 202579 - 202611
Alignment:
25 ggctaaaatatggttttggtccctgcaaatata 57  Q
    |||||||||||| ||||||||||||||||||||    
202579 ggctaaaatatgcttttggtccctgcaaatata 202611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University