View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1453_high_26 (Length: 249)
Name: NF1453_high_26
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1453_high_26 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 64 - 249
Target Start/End: Original strand, 37834516 - 37834701
Alignment:
| Q |
64 |
caacagataaaattggacaaccaaaaaatatatgattttttgtttcaactctgccacaatccaccaacacatagagaagaagagttcaggttcacccctc |
163 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37834516 |
caacagataaaattggacgaccaaaaaatatatgattttttgtttcaactctgccacaatccaccaacacatagagaagaagagttcaggttcacccctc |
37834615 |
T |
 |
| Q |
164 |
ttttactaagattttcctgagtaggaaactagaaatcctaccaactagtcagccacctcaaccgaacaactctactatcctcactt |
249 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| ||| | || ||| |||| ||| || ||||| ||| ||||||||| |
|
|
| T |
37834616 |
ttttactaagattttcctcagtaggaaactaggaatcctaacaaatggtaagctaccttaactgagaaactcgactctcctcactt |
37834701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 17 - 68
Target Start/End: Original strand, 37834427 - 37834478
Alignment:
| Q |
17 |
cagaaccagaaccagacccctgtgcacaatcagacgggactagactccaaca |
68 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37834427 |
cagagccagaaccagacccctgtgcacaatcagacaggactagactccaaca |
37834478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University