View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1453_high_32 (Length: 226)

Name: NF1453_high_32
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1453_high_32
NF1453_high_32
[»] chr7 (1 HSPs)
chr7 (101-226)||(2693825-2693946)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 2693946 - 2693825
Alignment:
101 gtgtcaatatgctctatgaatagagccattgtactccattttacgtatcttttactctgaaatgattctcgatcgagtctaattttcgttcaagctttta 200  Q
    |||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||    ||||||||||||| ||||||||||||||    
2693946 gtgtcaatatgctctatgaatagatccattgtactccattttacttatctcttactctgaaatgattc----tcgagtctaatttccgttcaagctttta 2693851  T
201 tagcttttatcactcaatttctttaa 226  Q
    ||||||||||||||||||||||||||    
2693850 tagcttttatcactcaatttctttaa 2693825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University