View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1453_low_29 (Length: 249)
Name: NF1453_low_29
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1453_low_29 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 40991661 - 40991421
Alignment:
| Q |
9 |
gataatacttggagttaagaataaatttaattttgttgatagaagtatagaacgattttagttcctacacaagtttcaaaaattggaatcggtgtaatat |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
40991661 |
gataacacttggagttaagaataaatttaattttgttgatagaagtatagaacgattttagttcctacacaagttgatcaaattggaatctgtgtaatat |
40991562 |
T |
 |
| Q |
109 |
gcttgtgcattcatttttcatgagtttcgttgataacttcgttgtacaaatcattgtatttcttgaaaattcaattgatgtttggatggaactcaaggaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40991561 |
gcttgtgcattcatttttcatgagtttcgttgataacttcgttgtacaaatcattgtatttcttgaaaattcaattgatgtttggatcaaactcaaggaa |
40991462 |
T |
 |
| Q |
209 |
cattttcttcgaggcgattacattcgtatttcagaacttta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40991461 |
cattttcttcgaggcgattacattcgtatttcagaacttta |
40991421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University