View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1453_low_36 (Length: 226)
Name: NF1453_low_36
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1453_low_36 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 2693946 - 2693825
Alignment:
| Q |
101 |
gtgtcaatatgctctatgaatagagccattgtactccattttacgtatcttttactctgaaatgattctcgatcgagtctaattttcgttcaagctttta |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
2693946 |
gtgtcaatatgctctatgaatagatccattgtactccattttacttatctcttactctgaaatgattc----tcgagtctaatttccgttcaagctttta |
2693851 |
T |
 |
| Q |
201 |
tagcttttatcactcaatttctttaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2693850 |
tagcttttatcactcaatttctttaa |
2693825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University