View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1453_low_38 (Length: 205)
Name: NF1453_low_38
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1453_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 36377476 - 36377580
Alignment:
| Q |
1 |
ctagagaagctggtgtcatcgtattcattggtgcattttgacttaattgctccactacctgctgttgttagtaataataatcaattcctaatttatacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36377476 |
ctagagaagctggtgtcatcgtattcattggtgcattttgacttaattgctccaccac---ctgttgttagtaataataatcaattcctaatttatacat |
36377572 |
T |
 |
| Q |
101 |
taatcaat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
36377573 |
taatcaat |
36377580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 132 - 175
Target Start/End: Original strand, 36377643 - 36377686
Alignment:
| Q |
132 |
caagattatttaatatgaggtgtcggctaagtgataaatttcgt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36377643 |
caagattatttaatatgaggtgtcggctcagtgataaatttcgt |
36377686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University