View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1453_low_38 (Length: 205)

Name: NF1453_low_38
Description: NF1453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1453_low_38
NF1453_low_38
[»] chr1 (2 HSPs)
chr1 (1-108)||(36377476-36377580)
chr1 (132-175)||(36377643-36377686)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 36377476 - 36377580
Alignment:
1 ctagagaagctggtgtcatcgtattcattggtgcattttgacttaattgctccactacctgctgttgttagtaataataatcaattcctaatttatacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||   |||||||||||||||||||||||||||||||||||||||    
36377476 ctagagaagctggtgtcatcgtattcattggtgcattttgacttaattgctccaccac---ctgttgttagtaataataatcaattcctaatttatacat 36377572  T
101 taatcaat 108  Q
    ||||||||    
36377573 taatcaat 36377580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 132 - 175
Target Start/End: Original strand, 36377643 - 36377686
Alignment:
132 caagattatttaatatgaggtgtcggctaagtgataaatttcgt 175  Q
    |||||||||||||||||||||||||||| |||||||||||||||    
36377643 caagattatttaatatgaggtgtcggctcagtgataaatttcgt 36377686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University