View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14540_low_7 (Length: 262)
Name: NF14540_low_7
Description: NF14540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14540_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 260
Target Start/End: Original strand, 53399328 - 53399570
Alignment:
| Q |
18 |
atggatgtgatgtatttttggcttcttttctttgaatttagattaacttgccgtacnnnnnnnatcctcaagacaacaaattgaagtacgaataatttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53399328 |
atggatgtgatgtatttttggcttcttttctttgaatttagattaatttgccgtactttttttatcctcaagacaacaaattgaagtacgaataatttca |
53399427 |
T |
 |
| Q |
118 |
acggagtcggcttgtttacaacgacgttactttcaacgcatttagtttaatgtgaacatttcataattcatgtgatgagggaaaaggactaataaaagtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53399428 |
acggagtcggcttgtttacaacgacgttactttcaacgcagttagtttaatttgaacatttcataattcatgtgatgaggtaaaaggactaataaaagtg |
53399527 |
T |
 |
| Q |
218 |
gtgtgcaattctttattttataaagtttttggagaataattta |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53399528 |
gtgtgcaattctttattttataaagtttttggagaaaaattta |
53399570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University