View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14541_high_12 (Length: 383)
Name: NF14541_high_12
Description: NF14541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14541_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 134 - 369
Target Start/End: Complemental strand, 48802531 - 48802296
Alignment:
| Q |
134 |
aaaaatttgtgatataagcgcttaattaaattgattggatccaaacaagaatacttgatgtgagattcaaattggttttatcttgatagatctttgttat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48802531 |
aaaaatttgtgatataagcgcttaattaaattgtttggatccaaacaagactacttgatgtgagattcaaattggttttatcttgatagatctttgttat |
48802432 |
T |
|
| Q |
234 |
ttcctccgaatcagtccatgcatcacatgttttgattctaagtgtagggttgttttgacttttgagagtttcatattgactagagatatgacttagatag |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48802431 |
ttcctccgaatcagtccatgcatcacatgttttgattctaagtgttgggttgttttgacttttgagagtttcatattgactagagatatgacttagatag |
48802332 |
T |
|
| Q |
334 |
tgcttgtaaggtttgagcagtccggatcctacaagt |
369 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
48802331 |
tgcttgttaggtttgagcagtccggatccaacaagt |
48802296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University