View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14541_low_16 (Length: 378)
Name: NF14541_low_16
Description: NF14541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14541_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 6e-59; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 166 - 359
Target Start/End: Original strand, 37789942 - 37790150
Alignment:
| Q |
166 |
tgtttacctcttgttttcatcttcttccacaaacgacaact---------tctaagttaacttgcttcctcgtttttgtggattgaactgaaaccccaaa |
256 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37789942 |
tgtttacctcttgttttcttcttcttccacaaacgacaactgcttcgccttctaagttaacttgcttcctcgtttttgtggattgaactgaaaccccaaa |
37790041 |
T |
 |
| Q |
257 |
gaaaaggcaacggtccgtgtcccctttcctttg-------tcgtcgtcaccattcccttgcagttgttcatattcacagttgttttatcatgaaacatct |
349 |
Q |
| |
|
||||||||||||||||||||||| || |||||| |||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
37790042 |
gaaaaggcaacggtccgtgtcccattacctttgtcgtcgttcgtcgtcaccattcccttgca-ctgttcatcgtcacggttgttttatcatgaaacatct |
37790140 |
T |
 |
| Q |
350 |
cttatcattg |
359 |
Q |
| |
|
|||||||||| |
|
|
| T |
37790141 |
cttatcattg |
37790150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 9 - 102
Target Start/End: Original strand, 37789785 - 37789878
Alignment:
| Q |
9 |
acatcatcagaaccaaaatgggcatatggaaccacaacatgcagacttcagtaataaactattgggatttctatatgccataggaagcagctgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37789785 |
acatcatcagaaccaaaatgggcatatggaactacaacatgcagacttcagtaataaactattgggatttctatatgccataggaagcagctgc |
37789878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 37800629 - 37800718
Alignment:
| Q |
13 |
catcagaaccaaaatgggcatatggaaccacaacatgcagacttcagtaataaactattgggatttctatatgccataggaagcagctgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
37800629 |
catcagaaccaaaatgggcatatggagccgcaacatgcagactttagtaataaactattgggcgttctatgtgctataggaagcagctgc |
37800718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University